ID: 1009366372

View in Genome Browser
Species Human (GRCh38)
Location 6:62860837-62860859
Sequence TCTTAAGATCCATTTGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366372_1009366389 24 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366389 6:62860884-62860906 CTCTTACTCCTCATATGGTGGGG No data
1009366372_1009366391 26 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366391 6:62860886-62860908 CTTACTCCTCATATGGTGGGGGG No data
1009366372_1009366390 25 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366390 6:62860885-62860907 TCTTACTCCTCATATGGTGGGGG No data
1009366372_1009366382 -3 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366382 6:62860857-62860879 AGAGCCAGGGAGGGGGAGAGAGG No data
1009366372_1009366383 -2 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366372_1009366386 19 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366386 6:62860879-62860901 GGGTGCTCTTACTCCTCATATGG No data
1009366372_1009366384 -1 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366384 6:62860859-62860881 AGCCAGGGAGGGGGAGAGAGGGG No data
1009366372_1009366387 22 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366387 6:62860882-62860904 TGCTCTTACTCCTCATATGGTGG No data
1009366372_1009366388 23 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366388 6:62860883-62860905 GCTCTTACTCCTCATATGGTGGG No data
1009366372_1009366381 -10 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366372 Original CRISPR TCTTAAGATCCATTTGGCAG GGG (reversed) Intergenic
No off target data available for this crispr