ID: 1009366374

View in Genome Browser
Species Human (GRCh38)
Location 6:62860839-62860861
Sequence GCTCTTAAGATCCATTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366374_1009366383 -4 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366374_1009366390 23 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366390 6:62860885-62860907 TCTTACTCCTCATATGGTGGGGG No data
1009366374_1009366388 21 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366388 6:62860883-62860905 GCTCTTACTCCTCATATGGTGGG No data
1009366374_1009366384 -3 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366384 6:62860859-62860881 AGCCAGGGAGGGGGAGAGAGGGG No data
1009366374_1009366387 20 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366387 6:62860882-62860904 TGCTCTTACTCCTCATATGGTGG No data
1009366374_1009366382 -5 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366382 6:62860857-62860879 AGAGCCAGGGAGGGGGAGAGAGG No data
1009366374_1009366389 22 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366389 6:62860884-62860906 CTCTTACTCCTCATATGGTGGGG No data
1009366374_1009366386 17 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366386 6:62860879-62860901 GGGTGCTCTTACTCCTCATATGG No data
1009366374_1009366391 24 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366391 6:62860886-62860908 CTTACTCCTCATATGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366374 Original CRISPR GCTCTTAAGATCCATTTGGC AGG (reversed) Intergenic
No off target data available for this crispr