ID: 1009366376

View in Genome Browser
Species Human (GRCh38)
Location 6:62860843-62860865
Sequence CCAAATGGATCTTAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366367_1009366376 6 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366376 6:62860843-62860865 CCAAATGGATCTTAAGAGCCAGG No data
1009366368_1009366376 5 Left 1009366368 6:62860815-62860837 CCATATGGCGGGGAGTGTCCACC No data
Right 1009366376 6:62860843-62860865 CCAAATGGATCTTAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366376 Original CRISPR CCAAATGGATCTTAAGAGCC AGG Intergenic
No off target data available for this crispr