ID: 1009366379

View in Genome Browser
Species Human (GRCh38)
Location 6:62860848-62860870
Sequence TGGATCTTAAGAGCCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366368_1009366379 10 Left 1009366368 6:62860815-62860837 CCATATGGCGGGGAGTGTCCACC No data
Right 1009366379 6:62860848-62860870 TGGATCTTAAGAGCCAGGGAGGG No data
1009366370_1009366379 -8 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366379 6:62860848-62860870 TGGATCTTAAGAGCCAGGGAGGG No data
1009366367_1009366379 11 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366379 6:62860848-62860870 TGGATCTTAAGAGCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366379 Original CRISPR TGGATCTTAAGAGCCAGGGA GGG Intergenic
No off target data available for this crispr