ID: 1009366381

View in Genome Browser
Species Human (GRCh38)
Location 6:62860850-62860872
Sequence GATCTTAAGAGCCAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366371_1009366381 -9 Left 1009366371 6:62860836-62860858 CCCCCTGCCAAATGGATCTTAAG No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data
1009366372_1009366381 -10 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data
1009366370_1009366381 -6 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data
1009366368_1009366381 12 Left 1009366368 6:62860815-62860837 CCATATGGCGGGGAGTGTCCACC No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data
1009366367_1009366381 13 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366381 Original CRISPR GATCTTAAGAGCCAGGGAGG GGG Intergenic
No off target data available for this crispr