ID: 1009366383

View in Genome Browser
Species Human (GRCh38)
Location 6:62860858-62860880
Sequence GAGCCAGGGAGGGGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366371_1009366383 -1 Left 1009366371 6:62860836-62860858 CCCCCTGCCAAATGGATCTTAAG No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366375_1009366383 -8 Left 1009366375 6:62860843-62860865 CCAAATGGATCTTAAGAGCCAGG No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366372_1009366383 -2 Left 1009366372 6:62860837-62860859 CCCCTGCCAAATGGATCTTAAGA No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366370_1009366383 2 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366374_1009366383 -4 Left 1009366374 6:62860839-62860861 CCTGCCAAATGGATCTTAAGAGC No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366368_1009366383 20 Left 1009366368 6:62860815-62860837 CCATATGGCGGGGAGTGTCCACC No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366367_1009366383 21 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366373_1009366383 -3 Left 1009366373 6:62860838-62860860 CCCTGCCAAATGGATCTTAAGAG No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366383 Original CRISPR GAGCCAGGGAGGGGGAGAGA GGG Intergenic
No off target data available for this crispr