ID: 1009366415

View in Genome Browser
Species Human (GRCh38)
Location 6:62860974-62860996
Sequence GTGGACACCCCCCGCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366415_1009366425 20 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366425 6:62861017-62861039 TAAGTGCCGCAGCAGGGGAGAGG No data
1009366415_1009366429 24 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366429 6:62861021-62861043 TGCCGCAGCAGGGGAGAGGGGGG No data
1009366415_1009366422 13 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366422 6:62861010-62861032 CAAATCGTAAGTGCCGCAGCAGG No data
1009366415_1009366426 21 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366426 6:62861018-62861040 AAGTGCCGCAGCAGGGGAGAGGG No data
1009366415_1009366428 23 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366428 6:62861020-62861042 GTGCCGCAGCAGGGGAGAGGGGG No data
1009366415_1009366423 14 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366423 6:62861011-62861033 AAATCGTAAGTGCCGCAGCAGGG No data
1009366415_1009366427 22 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366427 6:62861019-62861041 AGTGCCGCAGCAGGGGAGAGGGG No data
1009366415_1009366424 15 Left 1009366415 6:62860974-62860996 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366424 6:62861012-62861034 AATCGTAAGTGCCGCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366415 Original CRISPR GTGGACACCCCCCGCCATAT GGG (reversed) Intergenic
No off target data available for this crispr