ID: 1009366438

View in Genome Browser
Species Human (GRCh38)
Location 6:62861055-62861077
Sequence GTGGACACCCCCCGCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366438_1009366453 18 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366453 6:62861096-62861118 TGTAAGAGCCGGGGGTAGAGGGG No data
1009366438_1009366455 20 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366455 6:62861098-62861120 TAAGAGCCGGGGGTAGAGGGGGG No data
1009366438_1009366450 10 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366450 6:62861088-62861110 ACATGGATTGTAAGAGCCGGGGG No data
1009366438_1009366446 7 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366446 6:62861085-62861107 GCCACATGGATTGTAAGAGCCGG No data
1009366438_1009366449 9 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366449 6:62861087-62861109 CACATGGATTGTAAGAGCCGGGG No data
1009366438_1009366451 16 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366451 6:62861094-62861116 ATTGTAAGAGCCGGGGGTAGAGG No data
1009366438_1009366456 21 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366438_1009366454 19 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366454 6:62861097-62861119 GTAAGAGCCGGGGGTAGAGGGGG No data
1009366438_1009366452 17 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366452 6:62861095-62861117 TTGTAAGAGCCGGGGGTAGAGGG No data
1009366438_1009366440 -7 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366440 6:62861071-62861093 TGTCCACACCCCCTGCCACATGG No data
1009366438_1009366448 8 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366448 6:62861086-62861108 CCACATGGATTGTAAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366438 Original CRISPR GTGGACACCCCCCGCCATAT GGG (reversed) Intergenic
No off target data available for this crispr