ID: 1009366446

View in Genome Browser
Species Human (GRCh38)
Location 6:62861085-62861107
Sequence GCCACATGGATTGTAAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366438_1009366446 7 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366446 6:62861085-62861107 GCCACATGGATTGTAAGAGCCGG No data
1009366439_1009366446 6 Left 1009366439 6:62861056-62861078 CCATATGGCGGGGGGTGTCCACA No data
Right 1009366446 6:62861085-62861107 GCCACATGGATTGTAAGAGCCGG No data
1009366437_1009366446 8 Left 1009366437 6:62861054-62861076 CCCCATATGGCGGGGGGTGTCCA No data
Right 1009366446 6:62861085-62861107 GCCACATGGATTGTAAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366446 Original CRISPR GCCACATGGATTGTAAGAGC CGG Intergenic
No off target data available for this crispr