ID: 1009366456

View in Genome Browser
Species Human (GRCh38)
Location 6:62861099-62861121
Sequence AAGAGCCGGGGGTAGAGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366445_1009366456 -6 Left 1009366445 6:62861082-62861104 CCTGCCACATGGATTGTAAGAGC No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366439_1009366456 20 Left 1009366439 6:62861056-62861078 CCATATGGCGGGGGGTGTCCACA No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366447_1009366456 -10 Left 1009366447 6:62861086-62861108 CCACATGGATTGTAAGAGCCGGG No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366443_1009366456 -4 Left 1009366443 6:62861080-62861102 CCCCTGCCACATGGATTGTAAGA No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366437_1009366456 22 Left 1009366437 6:62861054-62861076 CCCCATATGGCGGGGGGTGTCCA No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366438_1009366456 21 Left 1009366438 6:62861055-62861077 CCCATATGGCGGGGGGTGTCCAC No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366442_1009366456 -3 Left 1009366442 6:62861079-62861101 CCCCCTGCCACATGGATTGTAAG No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366444_1009366456 -5 Left 1009366444 6:62861081-62861103 CCCTGCCACATGGATTGTAAGAG No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data
1009366441_1009366456 2 Left 1009366441 6:62861074-62861096 CCACACCCCCTGCCACATGGATT No data
Right 1009366456 6:62861099-62861121 AAGAGCCGGGGGTAGAGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366456 Original CRISPR AAGAGCCGGGGGTAGAGGGG GGG Intergenic
No off target data available for this crispr