ID: 1009367598

View in Genome Browser
Species Human (GRCh38)
Location 6:62867921-62867943
Sequence GTGTAAACCCCCTATGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009367593_1009367598 11 Left 1009367593 6:62867887-62867909 CCCAATAGAAATTACAGATAGTA No data
Right 1009367598 6:62867921-62867943 GTGTAAACCCCCTATGATATTGG No data
1009367594_1009367598 10 Left 1009367594 6:62867888-62867910 CCAATAGAAATTACAGATAGTAT No data
Right 1009367598 6:62867921-62867943 GTGTAAACCCCCTATGATATTGG No data
1009367591_1009367598 13 Left 1009367591 6:62867885-62867907 CCCCCAATAGAAATTACAGATAG No data
Right 1009367598 6:62867921-62867943 GTGTAAACCCCCTATGATATTGG No data
1009367592_1009367598 12 Left 1009367592 6:62867886-62867908 CCCCAATAGAAATTACAGATAGT No data
Right 1009367598 6:62867921-62867943 GTGTAAACCCCCTATGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009367598 Original CRISPR GTGTAAACCCCCTATGATAT TGG Intergenic
No off target data available for this crispr