ID: 1009367719

View in Genome Browser
Species Human (GRCh38)
Location 6:62868719-62868741
Sequence GCATAAGCCCCCCTGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009367719_1009367723 22 Left 1009367719 6:62868719-62868741 CCATAACACAGGGGGGCTTATGC No data
Right 1009367723 6:62868764-62868786 CCATCCTCTTTTTCCCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009367719 Original CRISPR GCATAAGCCCCCCTGTGTTA TGG (reversed) Intergenic
No off target data available for this crispr