ID: 1009369676

View in Genome Browser
Species Human (GRCh38)
Location 6:62883146-62883168
Sequence TATACACCACTTGTGATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009369676_1009369682 11 Left 1009369676 6:62883146-62883168 CCCAACATCACAAGTGGTGTATA No data
Right 1009369682 6:62883180-62883202 TATTGTTCCTAATACCCAGACGG No data
1009369676_1009369684 18 Left 1009369676 6:62883146-62883168 CCCAACATCACAAGTGGTGTATA No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009369676 Original CRISPR TATACACCACTTGTGATGTT GGG (reversed) Intergenic
No off target data available for this crispr