ID: 1009369677

View in Genome Browser
Species Human (GRCh38)
Location 6:62883147-62883169
Sequence ATATACACCACTTGTGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009369677_1009369684 17 Left 1009369677 6:62883147-62883169 CCAACATCACAAGTGGTGTATAT No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369677_1009369682 10 Left 1009369677 6:62883147-62883169 CCAACATCACAAGTGGTGTATAT No data
Right 1009369682 6:62883180-62883202 TATTGTTCCTAATACCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009369677 Original CRISPR ATATACACCACTTGTGATGT TGG (reversed) Intergenic
No off target data available for this crispr