ID: 1009369681 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:62883173-62883195 |
Sequence | GGTATTAGGAACAATATTAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1009369681_1009369684 | -9 | Left | 1009369681 | 6:62883173-62883195 | CCAATAATATTGTTCCTAATACC | No data | ||
Right | 1009369684 | 6:62883187-62883209 | CCTAATACCCAGACGGAGAGAGG | No data | ||||
1009369681_1009369687 | 19 | Left | 1009369681 | 6:62883173-62883195 | CCAATAATATTGTTCCTAATACC | No data | ||
Right | 1009369687 | 6:62883215-62883237 | ATTACTCCCAATATCGCAGAAGG | 0: 57 1: 375 2: 857 3: 1394 4: 1723 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1009369681 | Original CRISPR | GGTATTAGGAACAATATTAT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |