ID: 1009369681

View in Genome Browser
Species Human (GRCh38)
Location 6:62883173-62883195
Sequence GGTATTAGGAACAATATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009369681_1009369684 -9 Left 1009369681 6:62883173-62883195 CCAATAATATTGTTCCTAATACC No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369681_1009369687 19 Left 1009369681 6:62883173-62883195 CCAATAATATTGTTCCTAATACC No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009369681 Original CRISPR GGTATTAGGAACAATATTAT TGG (reversed) Intergenic
No off target data available for this crispr