ID: 1009369682

View in Genome Browser
Species Human (GRCh38)
Location 6:62883180-62883202
Sequence TATTGTTCCTAATACCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009369676_1009369682 11 Left 1009369676 6:62883146-62883168 CCCAACATCACAAGTGGTGTATA No data
Right 1009369682 6:62883180-62883202 TATTGTTCCTAATACCCAGACGG No data
1009369677_1009369682 10 Left 1009369677 6:62883147-62883169 CCAACATCACAAGTGGTGTATAT No data
Right 1009369682 6:62883180-62883202 TATTGTTCCTAATACCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009369682 Original CRISPR TATTGTTCCTAATACCCAGA CGG Intergenic
No off target data available for this crispr