ID: 1009369684

View in Genome Browser
Species Human (GRCh38)
Location 6:62883187-62883209
Sequence CCTAATACCCAGACGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009369677_1009369684 17 Left 1009369677 6:62883147-62883169 CCAACATCACAAGTGGTGTATAT No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369679_1009369684 -7 Left 1009369679 6:62883171-62883193 CCCCAATAATATTGTTCCTAATA No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369681_1009369684 -9 Left 1009369681 6:62883173-62883195 CCAATAATATTGTTCCTAATACC No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369678_1009369684 -6 Left 1009369678 6:62883170-62883192 CCCCCAATAATATTGTTCCTAAT No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369680_1009369684 -8 Left 1009369680 6:62883172-62883194 CCCAATAATATTGTTCCTAATAC No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
1009369676_1009369684 18 Left 1009369676 6:62883146-62883168 CCCAACATCACAAGTGGTGTATA No data
Right 1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009369684 Original CRISPR CCTAATACCCAGACGGAGAG AGG Intergenic
No off target data available for this crispr