ID: 1009369687

View in Genome Browser
Species Human (GRCh38)
Location 6:62883215-62883237
Sequence ATTACTCCCAATATCGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4406
Summary {0: 57, 1: 375, 2: 857, 3: 1394, 4: 1723}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009369685_1009369687 -2 Left 1009369685 6:62883194-62883216 CCCAGACGGAGAGAGGATGATAT No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723
1009369678_1009369687 22 Left 1009369678 6:62883170-62883192 CCCCCAATAATATTGTTCCTAAT No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723
1009369681_1009369687 19 Left 1009369681 6:62883173-62883195 CCAATAATATTGTTCCTAATACC No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723
1009369679_1009369687 21 Left 1009369679 6:62883171-62883193 CCCCAATAATATTGTTCCTAATA No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723
1009369680_1009369687 20 Left 1009369680 6:62883172-62883194 CCCAATAATATTGTTCCTAATAC No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723
1009369686_1009369687 -3 Left 1009369686 6:62883195-62883217 CCAGACGGAGAGAGGATGATATT No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723
1009369683_1009369687 5 Left 1009369683 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG No data
Right 1009369687 6:62883215-62883237 ATTACTCCCAATATCGCAGAAGG 0: 57
1: 375
2: 857
3: 1394
4: 1723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009369687 Original CRISPR ATTACTCCCAATATCGCAGA AGG Intergenic
Too many off-targets to display for this crispr