ID: 1009370476

View in Genome Browser
Species Human (GRCh38)
Location 6:62894376-62894398
Sequence GTGTGGATTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009370473_1009370476 13 Left 1009370473 6:62894340-62894362 CCACTTATTTCCACTTTCAATTA No data
Right 1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG No data
1009370474_1009370476 3 Left 1009370474 6:62894350-62894372 CCACTTTCAATTACATGCAAATT 0: 22
1: 98
2: 205
3: 271
4: 495
Right 1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009370476 Original CRISPR GTGTGGATTAATGCAAATTG AGG Intergenic
No off target data available for this crispr