ID: 1009372653

View in Genome Browser
Species Human (GRCh38)
Location 6:62926491-62926513
Sequence TAGCCAACAGAATTTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009372653_1009372660 29 Left 1009372653 6:62926491-62926513 CCTTCACCAAATTCTGTTGGCTA No data
Right 1009372660 6:62926543-62926565 CAAGGAAAGGGATTATGCGAAGG No data
1009372653_1009372655 11 Left 1009372653 6:62926491-62926513 CCTTCACCAAATTCTGTTGGCTA No data
Right 1009372655 6:62926525-62926547 CAGATACAACCCACACTTCAAGG No data
1009372653_1009372657 17 Left 1009372653 6:62926491-62926513 CCTTCACCAAATTCTGTTGGCTA No data
Right 1009372657 6:62926531-62926553 CAACCCACACTTCAAGGAAAGGG No data
1009372653_1009372656 16 Left 1009372653 6:62926491-62926513 CCTTCACCAAATTCTGTTGGCTA No data
Right 1009372656 6:62926530-62926552 ACAACCCACACTTCAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009372653 Original CRISPR TAGCCAACAGAATTTGGTGA AGG (reversed) Intergenic
No off target data available for this crispr