ID: 1009373239

View in Genome Browser
Species Human (GRCh38)
Location 6:62934815-62934837
Sequence GTCTCCCAGAAAAGAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009373239_1009373241 -6 Left 1009373239 6:62934815-62934837 CCAGGTTTTCTTTTCTGGGAGAC No data
Right 1009373241 6:62934832-62934854 GGAGACATGTTATTATGGCTTGG No data
1009373239_1009373243 24 Left 1009373239 6:62934815-62934837 CCAGGTTTTCTTTTCTGGGAGAC No data
Right 1009373243 6:62934862-62934884 TACTTGTTATTGGTCTGTTCAGG 0: 240
1: 979
2: 2721
3: 3075
4: 3298
1009373239_1009373242 14 Left 1009373239 6:62934815-62934837 CCAGGTTTTCTTTTCTGGGAGAC No data
Right 1009373242 6:62934852-62934874 TGGATATCATTACTTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009373239 Original CRISPR GTCTCCCAGAAAAGAAAACC TGG (reversed) Intergenic
No off target data available for this crispr