ID: 1009373629

View in Genome Browser
Species Human (GRCh38)
Location 6:62939374-62939396
Sequence AAGGAGAGCACAGTGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009373629_1009373636 25 Left 1009373629 6:62939374-62939396 CCTGCCATCACTGTGCTCTCCTT No data
Right 1009373636 6:62939422-62939444 TGTGTCATGCAGTTACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009373629 Original CRISPR AAGGAGAGCACAGTGATGGC AGG (reversed) Intergenic
No off target data available for this crispr