ID: 1009376364

View in Genome Browser
Species Human (GRCh38)
Location 6:62975427-62975449
Sequence ACAGTGCCACAGACTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009376364_1009376369 8 Left 1009376364 6:62975427-62975449 CCACGCCCAGTCTGTGGCACTGT No data
Right 1009376369 6:62975458-62975480 GTCTTACCAAACTAATAGACTGG No data
1009376364_1009376372 15 Left 1009376364 6:62975427-62975449 CCACGCCCAGTCTGTGGCACTGT No data
Right 1009376372 6:62975465-62975487 CAAACTAATAGACTGGGCAATGG No data
1009376364_1009376370 9 Left 1009376364 6:62975427-62975449 CCACGCCCAGTCTGTGGCACTGT No data
Right 1009376370 6:62975459-62975481 TCTTACCAAACTAATAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009376364 Original CRISPR ACAGTGCCACAGACTGGGCG TGG (reversed) Intergenic
No off target data available for this crispr