ID: 1009376370

View in Genome Browser
Species Human (GRCh38)
Location 6:62975459-62975481
Sequence TCTTACCAAACTAATAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009376364_1009376370 9 Left 1009376364 6:62975427-62975449 CCACGCCCAGTCTGTGGCACTGT No data
Right 1009376370 6:62975459-62975481 TCTTACCAAACTAATAGACTGGG No data
1009376365_1009376370 4 Left 1009376365 6:62975432-62975454 CCCAGTCTGTGGCACTGTTACGG No data
Right 1009376370 6:62975459-62975481 TCTTACCAAACTAATAGACTGGG No data
1009376367_1009376370 3 Left 1009376367 6:62975433-62975455 CCAGTCTGTGGCACTGTTACGGC No data
Right 1009376370 6:62975459-62975481 TCTTACCAAACTAATAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009376370 Original CRISPR TCTTACCAAACTAATAGACT GGG Intergenic
No off target data available for this crispr