ID: 1009380783

View in Genome Browser
Species Human (GRCh38)
Location 6:63026266-63026288
Sequence AAACTTGTCTTTACTGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009380783_1009380786 -7 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380786 6:63026282-63026304 CAAGTTTGGATTTATAACCAAGG No data
1009380783_1009380792 24 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380792 6:63026313-63026335 GGGAAGTAAGAGCAGACATCAGG No data
1009380783_1009380787 -1 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG No data
1009380783_1009380790 4 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380790 6:63026293-63026315 TTATAACCAAGGAGCAGGGTGGG 0: 5
1: 52
2: 120
3: 180
4: 302
1009380783_1009380788 0 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380788 6:63026289-63026311 GGATTTATAACCAAGGAGCAGGG 0: 3
1: 18
2: 96
3: 157
4: 307
1009380783_1009380789 3 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380789 6:63026292-63026314 TTTATAACCAAGGAGCAGGGTGG 0: 6
1: 43
2: 110
3: 175
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009380783 Original CRISPR AAACTTGTCTTTACTGGATT TGG (reversed) Intergenic
No off target data available for this crispr