ID: 1009380787

View in Genome Browser
Species Human (GRCh38)
Location 6:63026288-63026310
Sequence TGGATTTATAACCAAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009380783_1009380787 -1 Left 1009380783 6:63026266-63026288 CCAAATCCAGTAAAGACAAGTTT No data
Right 1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG No data
1009380785_1009380787 -7 Left 1009380785 6:63026272-63026294 CCAGTAAAGACAAGTTTGGATTT No data
Right 1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009380787 Original CRISPR TGGATTTATAACCAAGGAGC AGG Intergenic
No off target data available for this crispr