ID: 1009381128

View in Genome Browser
Species Human (GRCh38)
Location 6:63031456-63031478
Sequence CAGTAGTCTTAGTTGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009381125_1009381128 -3 Left 1009381125 6:63031436-63031458 CCTATTACATACATCACATTCAG No data
Right 1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG No data
1009381124_1009381128 -2 Left 1009381124 6:63031435-63031457 CCCTATTACATACATCACATTCA No data
Right 1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG No data
1009381122_1009381128 18 Left 1009381122 6:63031415-63031437 CCATGAAAATACCTAAATGTCCC No data
Right 1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG No data
1009381123_1009381128 7 Left 1009381123 6:63031426-63031448 CCTAAATGTCCCTATTACATACA No data
Right 1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG No data
1009381121_1009381128 25 Left 1009381121 6:63031408-63031430 CCAAAGTCCATGAAAATACCTAA No data
Right 1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009381128 Original CRISPR CAGTAGTCTTAGTTGTGGAT GGG Intergenic
No off target data available for this crispr