ID: 1009382437

View in Genome Browser
Species Human (GRCh38)
Location 6:63049180-63049202
Sequence TCCAATCTGTGCACATGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009382434_1009382437 -1 Left 1009382434 6:63049158-63049180 CCACTTTGTTGATATTGATTTTT No data
Right 1009382437 6:63049180-63049202 TCCAATCTGTGCACATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009382437 Original CRISPR TCCAATCTGTGCACATGGGA TGG Intergenic
No off target data available for this crispr