ID: 1009389626

View in Genome Browser
Species Human (GRCh38)
Location 6:63130390-63130412
Sequence CTAAGGATGGAGCTTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009389617_1009389626 1 Left 1009389617 6:63130366-63130388 CCTTGATGTGTTCTCCCTCTTCC No data
Right 1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG No data
1009389615_1009389626 14 Left 1009389615 6:63130353-63130375 CCATGGGGTGCTCCCTTGATGTG No data
Right 1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG No data
1009389614_1009389626 15 Left 1009389614 6:63130352-63130374 CCCATGGGGTGCTCCCTTGATGT No data
Right 1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG No data
1009389616_1009389626 2 Left 1009389616 6:63130365-63130387 CCCTTGATGTGTTCTCCCTCTTC No data
Right 1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009389626 Original CRISPR CTAAGGATGGAGCTTCCTGA GGG Intergenic