ID: 1009390111

View in Genome Browser
Species Human (GRCh38)
Location 6:63135068-63135090
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009390111_1009390114 15 Left 1009390111 6:63135068-63135090 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG 0: 21
1: 199
2: 184
3: 120
4: 249
1009390111_1009390113 -9 Left 1009390111 6:63135068-63135090 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1009390113 6:63135082-63135104 AAAGCTGTCTCTCAAAAAGATGG No data
1009390111_1009390115 16 Left 1009390111 6:63135068-63135090 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1009390115 6:63135107-63135129 GTTATCTGCAGAAGATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009390111 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr