ID: 1009392613

View in Genome Browser
Species Human (GRCh38)
Location 6:63163369-63163391
Sequence CAACAGAGGGAGACCGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009392613_1009392620 8 Left 1009392613 6:63163369-63163391 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1009392620 6:63163400-63163422 GGACTGTACTGCCGTGGTCTCGG 0: 10
1: 30
2: 51
3: 267
4: 3040
1009392613_1009392619 2 Left 1009392613 6:63163369-63163391 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1009392619 6:63163394-63163416 GAGGCTGGACTGTACTGCCGTGG 0: 8
1: 12
2: 2
3: 5
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009392613 Original CRISPR CAACAGAGGGAGACCGAAGA AGG (reversed) Intergenic
No off target data available for this crispr