ID: 1009394092

View in Genome Browser
Species Human (GRCh38)
Location 6:63177317-63177339
Sequence CAGTGCTCATCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009394092_1009394095 3 Left 1009394092 6:63177317-63177339 CCATCCACCACTGATGAGCACTG No data
Right 1009394095 6:63177343-63177365 TTGATTCCTTGTCTTTGCTACGG 0: 4
1: 71
2: 103
3: 237
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009394092 Original CRISPR CAGTGCTCATCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr