ID: 1009395038

View in Genome Browser
Species Human (GRCh38)
Location 6:63189845-63189867
Sequence ATGTGAGAGGGCCCCCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009395038_1009395041 9 Left 1009395038 6:63189845-63189867 CCATCGTGGGGGCCCTCTCACAT No data
Right 1009395041 6:63189877-63189899 TAAATTTAATCATCCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009395038 Original CRISPR ATGTGAGAGGGCCCCCACGA TGG (reversed) Intergenic
No off target data available for this crispr