ID: 1009396999

View in Genome Browser
Species Human (GRCh38)
Location 6:63211620-63211642
Sequence ACCTGCGTGATGCACTACAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 2, 2: 1, 3: 2, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009396992_1009396999 15 Left 1009396992 6:63211582-63211604 CCCCAGGAGACTGGCGCACCTTC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74
1009396997_1009396999 -8 Left 1009396997 6:63211605-63211627 CCGAAGCGCAGCCAGACCTGCGT 0: 1
1: 1
2: 1
3: 6
4: 109
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74
1009396991_1009396999 21 Left 1009396991 6:63211576-63211598 CCATCTCCCCAGGAGACTGGCGC 0: 1
1: 0
2: 3
3: 23
4: 534
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74
1009396994_1009396999 13 Left 1009396994 6:63211584-63211606 CCAGGAGACTGGCGCACCTTCCC 0: 1
1: 0
2: 1
3: 26
4: 176
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74
1009396996_1009396999 -7 Left 1009396996 6:63211604-63211626 CCCGAAGCGCAGCCAGACCTGCG 0: 1
1: 1
2: 2
3: 6
4: 85
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74
1009396993_1009396999 14 Left 1009396993 6:63211583-63211605 CCCAGGAGACTGGCGCACCTTCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74
1009396995_1009396999 -3 Left 1009396995 6:63211600-63211622 CCTTCCCGAAGCGCAGCCAGACC 0: 1
1: 0
2: 2
3: 13
4: 100
Right 1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG 0: 2
1: 2
2: 1
3: 2
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009396999 Original CRISPR ACCTGCGTGATGCACTACAC CGG Exonic
901812517 1:11775979-11776001 ACAGGCGTGAGCCACTACACCGG - Intronic
902606325 1:17571311-17571333 ACCTGCGGCCTCCACTACACCGG - Intronic
905182832 1:36177378-36177400 ACGGGCGTGAGGCACTACCCTGG - Intronic
905700836 1:40012420-40012442 ACAGGCGTGAGCCACTACACGGG - Intergenic
907591193 1:55673216-55673238 ACCTGGGTGATACACTCCATAGG - Intergenic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG + Intronic
916336878 1:163682139-163682161 TCCTGCGTGATGAACCACAAGGG + Intergenic
918730557 1:187988874-187988896 ACCTAGGTGATGCACTATATAGG - Intergenic
924600906 1:245488196-245488218 ACCAGCGTGAGCCACCACACTGG + Intronic
924834538 1:247635611-247635633 ACCTGCGTGTTCCACTTCCCTGG - Intergenic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1068721681 10:60252836-60252858 ACCTGCGTCATGCTTTACAGGGG + Intronic
1072783469 10:98265672-98265694 ACCAGCGTGAGCCACTACATCGG + Intronic
1084766198 11:71310452-71310474 ACAGGCGTGAGGCACCACACTGG - Intergenic
1089011214 11:115133258-115133280 ATCTCCGTAATGCACCACACTGG - Intergenic
1089209476 11:116790675-116790697 AGCCGCGTGGTGCACCACACCGG - Exonic
1091196045 11:133731440-133731462 ACCTGGGTCATGCACTAAATAGG + Intergenic
1091635916 12:2196544-2196566 AGCTGTGTTATGCACTAAACAGG - Intronic
1094284649 12:28779453-28779475 ACATGCGTGAGCCACCACACCGG - Intergenic
1096929772 12:55194554-55194576 ACCAGCATGAGGCACCACACTGG + Intergenic
1098298091 12:69024596-69024618 GCCTGGGTGACGCACTCCACTGG + Intergenic
1100162954 12:91882341-91882363 ACAGGCGTGAGGCACCACACAGG - Intergenic
1100169115 12:91952994-91953016 AGCTGCCTGAGGCACCACACAGG - Intergenic
1100257520 12:92899564-92899586 ACATTCCTGATGCATTACACAGG + Intronic
1100650557 12:96584185-96584207 ACAGGCGTGAGCCACTACACTGG - Intronic
1101611256 12:106294297-106294319 ACAGGCGTGAGCCACTACACTGG + Intronic
1103558488 12:121779835-121779857 ACCTGCGGGCTGCACTGCCCTGG - Exonic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1114228726 14:20761623-20761645 ACCTCCGTTATGCACTGCCCCGG + Intergenic
1116119107 14:40698689-40698711 ACCTGCTTTATGAACTACAAAGG - Intergenic
1119666535 14:76489073-76489095 ACCTGCAGGATTCACTGCACAGG + Intronic
1122183183 14:99970804-99970826 ACAGGCGTGAGGCACTACGCCGG + Intergenic
1122716439 14:103699362-103699384 ACCTGGTTGATGCACAGCACAGG + Exonic
1123001540 14:105297718-105297740 ACCAGCGTGAGCCACTGCACCGG - Intronic
1132278999 15:100596233-100596255 AACTGTGTCATGCACTAGACAGG + Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1135434487 16:22417066-22417088 ACATGCGTGAGCCACCACACTGG - Intronic
1137387089 16:48051646-48051668 ACCTTAGTGATGCACTCCAAGGG + Intergenic
1138621179 16:58212596-58212618 ACAGGCGTGAGCCACTACACTGG - Intergenic
1139551424 16:67675167-67675189 ACCTGTGTGAGGCACTTCAGCGG - Exonic
1140334483 16:74091856-74091878 ACAGGCGTGAGCCACTACACGGG + Intergenic
1141062351 16:80885035-80885057 ACAGGCGTGAGCCACTACACCGG - Intergenic
1146754279 17:35413469-35413491 ACAGGCGTGAGCCACTACACTGG - Intronic
1147847910 17:43418173-43418195 ACCTGGGTGATGCCAGACACTGG + Intergenic
1168221368 19:54962873-54962895 ACAGGCGTGAGGCACCACACTGG + Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
929281138 2:40080706-40080728 ACAGGCGTGAGCCACTACACCGG - Intergenic
935266775 2:101401726-101401748 ACCTGCGTCCTGCACTCCTCAGG + Intronic
948802657 2:240439921-240439943 ACCTGCGTGATGCAATGGCCTGG + Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1170847045 20:19971159-19971181 GCACGCGAGATGCACTACACTGG - Intronic
1174972660 20:55293922-55293944 ACTTGCTTGATGCAATGCACAGG + Intergenic
961743819 3:129050710-129050732 ACCTGCCTGATGCCCTGCCCTGG + Intergenic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
965651638 3:170939453-170939475 AACTGAGTGATGCTGTACACAGG - Intergenic
966881525 3:184353699-184353721 ACCTGCGTTTGGCACTGCACAGG - Exonic
971163074 4:24154161-24154183 ACCTGAGTGATGCCCTCCCCTGG + Intergenic
979264954 4:118690400-118690422 ACAAGCGTGAGGCACCACACTGG - Intronic
987701478 5:21405346-21405368 ACCTGCCAGGTGCACTCCACTGG + Intergenic
990558017 5:56954107-56954129 ACCTGCCTCATACATTACACTGG + Intronic
999277296 5:150339688-150339710 ACGTGCGTGAGCCACTACGCTGG - Intergenic
1000436796 5:161220934-161220956 AACTGAGTGATGTACTACAGTGG - Intergenic
1001081261 5:168669331-168669353 CCCTGCATGAGTCACTACACAGG - Intronic
1001977388 5:176011258-176011280 CCCTTCGTGAAGCACTCCACTGG - Intronic
1003512821 6:6795774-6795796 ACCTGAGTGACGCATCACACTGG + Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1010836941 6:80599920-80599942 ACTTGGGTGATGCACCACATTGG + Intergenic
1020895244 7:13931056-13931078 ACAGGCGTGATCCACTGCACCGG + Intronic
1021113039 7:16717229-16717251 ACAGGCGTGATCCACTGCACTGG + Intergenic
1026989310 7:74574418-74574440 ACAGGCGTGAGCCACTACACCGG + Intronic
1030887996 7:114962557-114962579 TCCTGCCTTATGCACTTCACTGG - Intronic
1033289633 7:140072335-140072357 ACCTGCGTTATGAAAAACACAGG - Intergenic
1033735501 7:144217892-144217914 ACAGGCGTGAGCCACTACACCGG - Intergenic
1033747553 7:144333078-144333100 ACAGGCGTGAGCCACTACACCGG + Intergenic
1043145766 8:76651937-76651959 ACTTACGTGATGAAATACACAGG + Intergenic
1058128318 9:101221699-101221721 ACCTGCAGGAAGCAGTACACAGG + Intronic
1061812886 9:133172850-133172872 ACATGCGTGAGCCACTGCACTGG + Intergenic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1195114329 X:101681842-101681864 ACAGGCGTGAGCCACTACACTGG - Intergenic