ID: 1009398417

View in Genome Browser
Species Human (GRCh38)
Location 6:63228715-63228737
Sequence CTCACTGCCCAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009398411_1009398417 -7 Left 1009398411 6:63228699-63228721 CCTGGCAGAGGCACTCCTCACTG No data
Right 1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG No data
1009398409_1009398417 9 Left 1009398409 6:63228683-63228705 CCAGACAGGGCGGCAGCCTGGCA No data
Right 1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG No data
1009398406_1009398417 18 Left 1009398406 6:63228674-63228696 CCTCACTTCCCAGACAGGGCGGC 0: 97
1: 1306
2: 6359
3: 11527
4: 5539
Right 1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG No data
1009398408_1009398417 10 Left 1009398408 6:63228682-63228704 CCCAGACAGGGCGGCAGCCTGGC No data
Right 1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009398417 Original CRISPR CTCACTGCCCAGATGGGGCA GGG Intergenic
No off target data available for this crispr