ID: 1009398635

View in Genome Browser
Species Human (GRCh38)
Location 6:63229782-63229804
Sequence GGCTGCTTCCCCATTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009398624_1009398635 25 Left 1009398624 6:63229734-63229756 CCAGGAGGAAGTGAGGTTTCCCT No data
Right 1009398635 6:63229782-63229804 GGCTGCTTCCCCATTGCTACAGG No data
1009398629_1009398635 5 Left 1009398629 6:63229754-63229776 CCTGAGTCTCCAGGGGCCCAGAG 0: 1
1: 11
2: 3
3: 35
4: 390
Right 1009398635 6:63229782-63229804 GGCTGCTTCCCCATTGCTACAGG No data
1009398628_1009398635 6 Left 1009398628 6:63229753-63229775 CCCTGAGTCTCCAGGGGCCCAGA 0: 1
1: 10
2: 5
3: 40
4: 265
Right 1009398635 6:63229782-63229804 GGCTGCTTCCCCATTGCTACAGG No data
1009398632_1009398635 -4 Left 1009398632 6:63229763-63229785 CCAGGGGCCCAGAGGTGAAGGCT 0: 1
1: 0
2: 10
3: 60
4: 688
Right 1009398635 6:63229782-63229804 GGCTGCTTCCCCATTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009398635 Original CRISPR GGCTGCTTCCCCATTGCTAC AGG Intergenic
No off target data available for this crispr