ID: 1009399690

View in Genome Browser
Species Human (GRCh38)
Location 6:63239617-63239639
Sequence GAGCAAAGTTCATGTAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009399685_1009399690 30 Left 1009399685 6:63239564-63239586 CCAATAACCATTTGAAGAAAGAT No data
Right 1009399690 6:63239617-63239639 GAGCAAAGTTCATGTAGTGGTGG No data
1009399686_1009399690 23 Left 1009399686 6:63239571-63239593 CCATTTGAAGAAAGATGTGAATC No data
Right 1009399690 6:63239617-63239639 GAGCAAAGTTCATGTAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009399690 Original CRISPR GAGCAAAGTTCATGTAGTGG TGG Intergenic
No off target data available for this crispr