ID: 1009404890

View in Genome Browser
Species Human (GRCh38)
Location 6:63300118-63300140
Sequence GGGCAGGGCCATAGTGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 367}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009404890_1009404905 21 Left 1009404890 6:63300118-63300140 CCAAGCCCACTATGGCCCTGCCC 0: 1
1: 0
2: 2
3: 45
4: 367
Right 1009404905 6:63300162-63300184 CTGGCCATGCTGAGAGGGGTTGG No data
1009404890_1009404901 15 Left 1009404890 6:63300118-63300140 CCAAGCCCACTATGGCCCTGCCC 0: 1
1: 0
2: 2
3: 45
4: 367
Right 1009404901 6:63300156-63300178 TGCCTGCTGGCCATGCTGAGAGG 0: 1
1: 0
2: 7
3: 42
4: 288
1009404890_1009404904 17 Left 1009404890 6:63300118-63300140 CCAAGCCCACTATGGCCCTGCCC 0: 1
1: 0
2: 2
3: 45
4: 367
Right 1009404904 6:63300158-63300180 CCTGCTGGCCATGCTGAGAGGGG 0: 1
1: 0
2: 8
3: 39
4: 323
1009404890_1009404898 2 Left 1009404890 6:63300118-63300140 CCAAGCCCACTATGGCCCTGCCC 0: 1
1: 0
2: 2
3: 45
4: 367
Right 1009404898 6:63300143-63300165 CCTCCTCCAGCTTTGCCTGCTGG No data
1009404890_1009404902 16 Left 1009404890 6:63300118-63300140 CCAAGCCCACTATGGCCCTGCCC 0: 1
1: 0
2: 2
3: 45
4: 367
Right 1009404902 6:63300157-63300179 GCCTGCTGGCCATGCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009404890 Original CRISPR GGGCAGGGCCATAGTGGGCT TGG (reversed) Intronic
900004748 1:37518-37540 GGGCAGGGCCAAGGGCGGCTTGG + Intergenic
900191979 1:1355827-1355849 GGGCAGGGCCCTGGTGGGGGAGG + Intronic
900299325 1:1969196-1969218 GGGCAGGGCTAGGCTGGGCTGGG - Intronic
900555321 1:3277406-3277428 GGGTAGGGCCCTGGTGGCCTGGG - Intronic
902076440 1:13790507-13790529 GGGCAAGGCCCAAGGGGGCTTGG - Intronic
902255916 1:15188503-15188525 GGGTATGGCCATGCTGGGCTGGG - Intronic
902387396 1:16083638-16083660 GGGAAGGGCAGGAGTGGGCTGGG - Intergenic
902984996 1:20149694-20149716 GGCCAGGGCCTTACGGGGCTGGG + Exonic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
903240666 1:21980787-21980809 GGAAAGGGCCTCAGTGGGCTGGG - Intronic
903244409 1:22005410-22005432 GGAAAGGGCCTCAGTGGGCTGGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904259995 1:29282960-29282982 GGCCAGGGTCATGGTGGGCGTGG + Intronic
904392183 1:30193233-30193255 GGGCAGTGCCAGATGGGGCTGGG + Intergenic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905767011 1:40609809-40609831 GGGCAGGGCCATGGTGGTTTAGG - Intergenic
905886677 1:41495574-41495596 GGGCAGGGCCATACTGGGATGGG - Intergenic
906124974 1:43422239-43422261 GGGCTGGGCCATAGTTGGGGTGG + Intronic
906414368 1:45608673-45608695 AGGTAGGGAAATAGTGGGCTAGG + Intronic
909701957 1:78535047-78535069 GGGCAGTGCCCTAGTGTTCTGGG + Intronic
909865409 1:80662220-80662242 GGGCAGGGCCATGAGGGGCAGGG + Intergenic
912410530 1:109477975-109477997 GGCCAGGCCCATAGAGGGCGTGG - Exonic
912505440 1:110152584-110152606 GAGCAGGGCCAGGCTGGGCTGGG + Intronic
912511931 1:110195519-110195541 GGGCAGGGCCCTGGGGGTCTCGG - Intronic
914988236 1:152477766-152477788 GGGCATGCCCACAGTGGACTGGG - Intergenic
915279710 1:154814076-154814098 AGGGAGGGCCATGGTGGGCATGG + Intronic
915367431 1:155323861-155323883 GGGCCGGGCGAGAGTGGGCGGGG - Intronic
915485751 1:156219456-156219478 ACTCAGGGACATAGTGGGCTAGG - Intronic
915598123 1:156906773-156906795 AGGCAGGGCCATAGTAGCCAGGG - Exonic
915971340 1:160357262-160357284 GGGCAGGGGCATAGGTGGCAGGG + Intronic
916990467 1:170238099-170238121 GGGCAGGAGCACAGTGGGCCGGG + Intergenic
917826198 1:178823756-178823778 GAGAAGGACCATTGTGGGCTGGG + Intronic
919811737 1:201412989-201413011 GGGCATGGCCATAATGGGTTGGG - Intronic
920404796 1:205701256-205701278 GGGCAGGGACACAGTGGGGGAGG - Intergenic
921801643 1:219409377-219409399 GGTCAAGGCTGTAGTGGGCTGGG + Intergenic
922752896 1:228079198-228079220 GGGCAGGGCCACCCTGAGCTGGG + Intergenic
1064261258 10:13788244-13788266 GGGCAGGGAAATAGTGGCCCTGG - Intronic
1065145975 10:22768486-22768508 GGGCTGGTCCAGAGTGGACTGGG + Intergenic
1065175324 10:23069871-23069893 GGGCAGGGTAGTAGTGGGTTAGG + Intergenic
1065395461 10:25231956-25231978 GGGCAGGGCAAGAGTAGGCTGGG + Intronic
1065530165 10:26661349-26661371 GGGCAGGCGGATAGTGGCCTGGG + Intergenic
1065556794 10:26923809-26923831 GGGCAGGCAGATAGTGGCCTGGG - Intergenic
1065993240 10:31032453-31032475 GGGCAAGGCCTAAGTGGGCGTGG - Intergenic
1066351717 10:34642387-34642409 AGGCAGGGCCAGATGGGGCTGGG - Intronic
1066760065 10:38741384-38741406 GGGCAGGGCAATGCAGGGCTGGG - Intergenic
1067776753 10:49169942-49169964 GGGCAGGGCCTCAGTGGGTGGGG + Intronic
1068117747 10:52752618-52752640 GGGGATGGGCATAGTGGGCCAGG + Intergenic
1069359653 10:67627160-67627182 GGATGGGGCCATATTGGGCTTGG - Intronic
1069592008 10:69647964-69647986 GGTCAAGGCCATCGTGGGGTGGG + Intergenic
1069715079 10:70515430-70515452 GGGCAGAGCCAGGCTGGGCTGGG - Intronic
1069755597 10:70772777-70772799 CGGCAGGGCCACAGTTGTCTGGG - Intronic
1069857799 10:71451290-71451312 GGGCAGGGCCATCCATGGCTGGG - Intronic
1069921451 10:71818149-71818171 GGCCAGGGCCACAGTGCCCTAGG + Intronic
1070313865 10:75293316-75293338 GGGCAAGGTCATTGTGGGCCAGG + Intergenic
1070391037 10:75970704-75970726 GGGCAGGCCCAGTGTGGGCTTGG + Intronic
1072790484 10:98314125-98314147 GGGCAGCTCCATGGTGGGCCTGG + Intergenic
1073452802 10:103619596-103619618 GGGCTGGGCCCTAGTGGCCCAGG - Intronic
1073546634 10:104354608-104354630 GGGTAGGGCCATAGTGGATGGGG - Intronic
1073735031 10:106336035-106336057 GGGGTGGGCCAAAGTGGTCTTGG - Intergenic
1074065232 10:110007769-110007791 GGGCGGGGCCAGAGAGAGCTCGG + Intronic
1074192583 10:111150627-111150649 GGGCAGGGCAAGAGGTGGCTGGG - Intergenic
1075641054 10:124064834-124064856 GGGCAGGGCCAGTGTGGTCTGGG - Intronic
1076322941 10:129596963-129596985 AGGAAGGGGCTTAGTGGGCTGGG + Intronic
1076649789 10:131979997-131980019 GGACGGGGCCACTGTGGGCTCGG - Intronic
1076704460 10:132293669-132293691 AGGCAGGGCCAGAGTGGGGGTGG + Intronic
1076746407 10:132517028-132517050 GGCCAGGGCCACAGTGGGGCGGG + Intergenic
1076785143 10:132745844-132745866 GGGCCCGGCCATGGTGGCCTCGG + Intronic
1077268941 11:1666163-1666185 GGGCAGAGCCACAGCAGGCTGGG - Intergenic
1077271811 11:1685017-1685039 GGGCAGAGCCACAGCAGGCTGGG + Intergenic
1077442827 11:2576692-2576714 GGGCAAGGCCAGAAGGGGCTGGG + Intronic
1077488486 11:2849934-2849956 GGGCACGGGCCCAGTGGGCTTGG - Intergenic
1078605977 11:12775996-12776018 CGGCAGGGTCACAGTGGGCAGGG + Intronic
1079239682 11:18713825-18713847 GGGCAGGGCCAGTCCGGGCTGGG - Intronic
1081379309 11:42395055-42395077 GGGTAGGGCACTCGTGGGCTGGG - Intergenic
1081611419 11:44565489-44565511 GGGTACGGCCATAGTGGGCGGGG + Intronic
1081693304 11:45092951-45092973 GGTCAGGGCAAGCGTGGGCTTGG - Intergenic
1083185536 11:61015803-61015825 GGTCAGGGCCACAGGAGGCTGGG - Exonic
1083271923 11:61577061-61577083 GGGCTGGGGCATAGTGGGGAGGG - Intronic
1083617266 11:64032485-64032507 GGGCAGGGCCAGGGTGACCTTGG + Intronic
1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG + Intergenic
1083672567 11:64307271-64307293 GGCCAGGGCCACAGGAGGCTCGG - Exonic
1083761944 11:64823610-64823632 GGGAAGGGCCAGAGTGTGCCCGG + Exonic
1084149813 11:67282835-67282857 GTGCAGGGCCGCAGGGGGCTGGG + Intronic
1084907168 11:72357148-72357170 GGGCAGGTCCCTTGTAGGCTTGG + Intronic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1085151857 11:74258675-74258697 GGGCAGGGGCATGGAGGACTAGG + Intronic
1085514079 11:77102369-77102391 AGGCAGGACCAGAGAGGGCTTGG - Intronic
1090426132 11:126608169-126608191 GGGGCGGGCCATGGTGGGCCAGG + Intronic
1090452545 11:126819449-126819471 GGGCAGGGCCATTGTGTGGGAGG + Intronic
1096174820 12:49507229-49507251 AGGCAGGGCCACTGTGGGGTGGG + Intronic
1097057538 12:56258686-56258708 GGGCGGGAGCATTGTGGGCTGGG - Intergenic
1097352424 12:58562906-58562928 GGGGAGGGCCAGAGTGGTCTTGG + Intronic
1100930754 12:99607108-99607130 GGATGGGGCCATACTGGGCTTGG + Intronic
1102544605 12:113645654-113645676 GGCCAGGGGCAGAGAGGGCTGGG - Intergenic
1103155944 12:118684987-118685009 GGGAAGGGAGAGAGTGGGCTAGG + Intergenic
1103437498 12:120938011-120938033 GGGCAGTGCCAAAGAGGGGTTGG - Intergenic
1104789535 12:131473061-131473083 GGGCAGGGCAGCTGTGGGCTGGG + Intergenic
1105344600 13:19561145-19561167 GGCCAGGGCCACAGGAGGCTCGG + Intergenic
1105535438 13:21260428-21260450 GGCCAGGGCCACAGGAGGCTCGG - Intergenic
1108016833 13:46085546-46085568 GGGCAGGTCCAAAGAAGGCTGGG - Intronic
1108068894 13:46607110-46607132 GGGCAGGGGAAATGTGGGCTGGG + Intronic
1112929194 13:104713802-104713824 GTGGTGGGCCATAGTGGTCTTGG - Intergenic
1113253833 13:108485706-108485728 GAGCAGAGCCATGCTGGGCTGGG + Intergenic
1113784627 13:112995949-112995971 GGGCAGGGCTGTACTGTGCTTGG - Intronic
1114556351 14:23564524-23564546 GGGCGGGGCCGTAGTGGGAGAGG + Intronic
1117396641 14:55317150-55317172 GGGAAGGGGTAGAGTGGGCTCGG + Intronic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119895343 14:78215190-78215212 GGAGAGGGCCAGAGTGGGCTCGG - Intergenic
1120173888 14:81273619-81273641 GGGCTGGGCCAGGCTGGGCTGGG + Intronic
1121129983 14:91437386-91437408 GGGGAGGGACCTAGTGGGCAGGG + Intergenic
1121818340 14:96945096-96945118 GGGCTGGGCAGTGGTGGGCTGGG - Intergenic
1122015945 14:98796639-98796661 GTGCAGGGCCATTCTGGACTTGG - Intergenic
1122052191 14:99067668-99067690 GGGCTGGGCCAAGCTGGGCTGGG - Intergenic
1122386422 14:101351293-101351315 GGGCAGGGCCAGTGAGGGCAAGG + Intergenic
1122907049 14:104806401-104806423 GGGCAGAGCCTCTGTGGGCTTGG - Intergenic
1123059959 14:105590151-105590173 GGGCTGGGCTAGATTGGGCTGGG - Intergenic
1123060024 14:105590386-105590408 GGGCTGGGCTAGATTGGGCTGGG - Intergenic
1123060098 14:105590636-105590658 GGGCTGGGCTAGATTGGGCTGGG - Intergenic
1123060167 14:105590876-105590898 GGGCTGGGCTAGATTGGGCTGGG - Intergenic
1123060194 14:105590976-105590998 GGGCTGGGCTAGATTGGGCTGGG - Intergenic
1202832684 14_GL000009v2_random:53883-53905 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1124218072 15:27825802-27825824 GGACTGGGGCATAGTGGGCTGGG - Intronic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125745911 15:41997042-41997064 GGGCAGGGCCTGGGTTGGCTGGG + Intronic
1128212247 15:65910862-65910884 GAGCAGGGCCATGGTGGGAGTGG - Intronic
1128285646 15:66434871-66434893 GGGCAGAGCCACAGTGGGAGGGG + Intronic
1128363238 15:66977471-66977493 GGGCAGGGGCATTGTGGGCAGGG - Intergenic
1128565812 15:68699865-68699887 GCTCAGGGCCATGGTGGGCTGGG + Intronic
1128684999 15:69677435-69677457 GGGTGGGGCCCTAGTGTGCTGGG + Intergenic
1129161628 15:73751242-73751264 GCCCAGGGCCAGGGTGGGCTGGG - Exonic
1129220691 15:74130113-74130135 GGGCAGGGCTGCGGTGGGCTGGG + Intronic
1129287961 15:74541137-74541159 GGGCGGGGCCACAGGGGGCGGGG - Intergenic
1129457611 15:75684010-75684032 GGGCGGGGCCTTGGTGGTCTAGG - Intronic
1129631654 15:77266993-77267015 GGGCAGGGGCACAGTGGGAGTGG + Intronic
1129714615 15:77839877-77839899 GAGCAGGGGCCTAGTGGGGTTGG - Intergenic
1130105392 15:80924978-80925000 GAGCAGGGCCACAGTAGGTTGGG + Intronic
1130320858 15:82839358-82839380 GGGCTGGGGCATATTAGGCTTGG - Intronic
1131154714 15:90067736-90067758 AGGCAGCGCCATGCTGGGCTCGG - Exonic
1132448762 15:101953426-101953448 GGGCAGGGCCAAGGGCGGCTTGG - Intergenic
1132499708 16:280069-280091 GGGCGGGACCACAGTGGGCGCGG - Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1133328721 16:4958196-4958218 GGGCGGGGCCAGAGTGGGGCGGG + Intronic
1133328734 16:4958229-4958251 GGGCAGGGCCAACCTGGGCGGGG + Intronic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1136398480 16:30005456-30005478 GGGCGGGGCCGTGGTGGGCATGG - Exonic
1136460630 16:30407969-30407991 GGCCAGGGCCACGGTGGGCGGGG + Intronic
1137489894 16:48923595-48923617 AGGCAGGGCCATGGTGGCCATGG + Intergenic
1137561520 16:49505510-49505532 GGGCTGGGCCATGAGGGGCTGGG - Intronic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1139401086 16:66681993-66682015 AGGCCTGGCGATAGTGGGCTTGG - Intronic
1140134724 16:72195812-72195834 GGCCAGGGCCGTCCTGGGCTGGG + Intergenic
1140540045 16:75748694-75748716 GGGCAGGGCACCAGTGAGCTAGG - Intronic
1141141334 16:81498572-81498594 GGGCAGGGGCATGGAGGGATGGG - Intronic
1141463445 16:84191681-84191703 GGGCAGAGCCACGGAGGGCTGGG + Intronic
1142420030 16:89964379-89964401 GGCCAGGGACACACTGGGCTGGG - Intronic
1142848197 17:2692124-2692146 GGGAAGGGCATAAGTGGGCTGGG + Intronic
1143376442 17:6470320-6470342 GGGCAGGGCCACGGTGGGGAAGG + Exonic
1143509923 17:7389852-7389874 AGGCAGGGCCCTAGTGGGAGAGG + Exonic
1144447138 17:15341602-15341624 GGCCAGGGCCAGACTGGTCTGGG - Exonic
1144857442 17:18277569-18277591 AGGCAGGGTCATGGTGGGATTGG - Intronic
1145205585 17:20983459-20983481 GGGCAGGGCCAGAGTAGGGGAGG + Intergenic
1145785531 17:27591445-27591467 ATGCAGGGGCAGAGTGGGCTGGG - Intronic
1145977418 17:28992524-28992546 GGGTAGGGCCTTTCTGGGCTTGG - Intronic
1148152593 17:45405309-45405331 GGGCAGGGCTGGAGTGGGCGGGG - Intronic
1148748669 17:49932209-49932231 GGGCAGAGCCAGGGTGGGCCAGG - Intergenic
1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG + Intergenic
1149860174 17:60118002-60118024 GGGCAGCCCCACAGAGGGCTGGG - Intergenic
1149868061 17:60161603-60161625 GGTCAGGGGCATGGGGGGCTCGG - Intronic
1151443352 17:74147944-74147966 GGGCAGGGCCATCCTGGTCCTGG - Intergenic
1151668801 17:75560173-75560195 GGGCAGGGCATGACTGGGCTGGG + Intronic
1151729201 17:75901057-75901079 TGGCAGGGCCGTGGTCGGCTGGG - Intronic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152029993 17:77836285-77836307 GGGCAAGGCCAGAGTTGGCTTGG - Intergenic
1152650283 17:81489379-81489401 GGCCAGGGCCGTGGGGGGCTGGG - Intergenic
1154087351 18:11320436-11320458 GGGCAGGGGAATAATGGACTGGG - Intergenic
1156260818 18:35443786-35443808 GGGCCAGGCCATACTGGGCCAGG + Intergenic
1156483652 18:37451226-37451248 GGACAGGCCCATTGTGGGCCAGG + Intronic
1157834810 18:50890917-50890939 GGGCAGGGCCATATTGAGCCTGG + Intronic
1158380897 18:56928620-56928642 GTGCAGGGATATAGTGGCCTGGG + Intronic
1158596809 18:58823929-58823951 GGGGAGGGCCTTTGAGGGCTGGG - Intergenic
1159736140 18:72100280-72100302 GGGCAGTGGCATTGTGGCCTGGG + Intergenic
1160146758 18:76371595-76371617 TGGCAGGGCCGTGGTGGGGTTGG + Intronic
1160492782 18:79351894-79351916 GGGCAAGGGCAGAGTGGGCTTGG - Intronic
1160636500 19:79127-79149 GGGCAGGGCCAAGGGCGGCTTGG + Intergenic
1160821969 19:1063051-1063073 GGGCAGGGCCATGGTGTGGGTGG - Intronic
1160822032 19:1063279-1063301 GGGCAGGGCCATAGTGTGGGTGG - Intronic
1160822078 19:1063433-1063455 GAGCAGGGGCATAATGGGCATGG - Intronic
1160822088 19:1063472-1063494 GGGCAGGGCCACAGTGTGGCGGG - Intronic
1161793236 19:6373174-6373196 GGGCAGGGCCACACTGGGGGCGG + Intronic
1161793406 19:6373722-6373744 GGGCAGGGCCTTTTTGGGGTCGG + Intronic
1161853419 19:6750636-6750658 GAGAACGGCCAGAGTGGGCTTGG + Intronic
1162573142 19:11483884-11483906 GGGCGGGGTCAGAGTGGGCGGGG + Intronic
1162798980 19:13100863-13100885 GTGCAGGGCCAAAGTGGGCGGGG + Exonic
1162871674 19:13591154-13591176 GGGCAGGGCCTTATGGGTCTTGG + Intronic
1162930827 19:13956677-13956699 GGGCAGGGCTGTGGTGGGCGTGG - Intronic
1163492765 19:17626568-17626590 GGGCAGGGCCATAGAGACCCAGG - Intronic
1163518347 19:17778356-17778378 GGGCGGGGCCAGAGTGCGCGTGG + Intronic
1163541932 19:17916721-17916743 TGGCTGGGCCAGGGTGGGCTGGG - Intergenic
1163809421 19:19421338-19421360 GGGCAGGGCCATAGGGGCAGGGG - Intronic
1164462286 19:28459209-28459231 GGGCAGGCCCATGGAGGGTTGGG + Intergenic
1165797233 19:38526320-38526342 GGGGAGGGCTATAGGGGTCTTGG - Intronic
1165799230 19:38537442-38537464 GGGCAGGGGAAGATTGGGCTGGG - Intronic
1165879346 19:39031739-39031761 GGGCAGGGCCGCAGTGGGACCGG - Intronic
1165943512 19:39427529-39427551 TGGCCAGGCCATAGTGGTCTTGG + Exonic
1166093611 19:40526015-40526037 GGGCAGAGCCATACAGAGCTGGG + Intronic
1166104032 19:40588939-40588961 GGGCAGGGCCAGAGAGGGCTGGG - Intronic
1166393544 19:42423486-42423508 GGCCGGGGCCATAGCGGCCTCGG + Intronic
1166562824 19:43744701-43744723 GAGCAGGGGCAAGGTGGGCTTGG - Intronic
1166809997 19:45508883-45508905 GGGCGGGGCCAGTGTGGGCAGGG + Intronic
1167090528 19:47340952-47340974 GGGCAATGCCATGGTGGCCTGGG + Exonic
1167391834 19:49200442-49200464 GGGCGGGGCCAAAGTGGGCGGGG + Intronic
1168598181 19:57695911-57695933 GGACAGGGGCTGAGTGGGCTGGG - Intronic
1202639997 1_KI270706v1_random:73848-73870 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
925868179 2:8247048-8247070 GGGCAGGGCCATTCTCAGCTAGG + Intergenic
926305594 2:11635516-11635538 GGGCAGGGCCCTACTGGGTGGGG + Intronic
926423769 2:12723116-12723138 AGGCAGGGCCAATGTGGTCTGGG + Intronic
927052919 2:19348077-19348099 GGGCGGGGCCGCAGTGGGCGCGG + Intergenic
931664230 2:64598844-64598866 GGCCAGGGGCATGGTGGGGTCGG - Intergenic
934649646 2:96083632-96083654 GGGCAGGGCCTGGGAGGGCTTGG - Intergenic
934845841 2:97660894-97660916 GGGCTGGGCCATGGAGGGCTGGG - Intronic
936444448 2:112585094-112585116 GGGCAAGGTCAGAGTGGTCTAGG - Intronic
936564981 2:113575913-113575935 GGGCAGGGCCAAGGGCGGCTTGG - Intergenic
940863253 2:158791581-158791603 GGGCAGCCCCAAAGTGGGGTGGG - Intergenic
941428645 2:165384070-165384092 GGACAAGGACATAGTGGTCTAGG + Intronic
941783935 2:169478236-169478258 AGGCAGGGCCACATTGAGCTAGG + Intergenic
942426910 2:175869690-175869712 GTACAGGGCCCTAGTGGGATGGG - Intergenic
945194899 2:207228610-207228632 GAACAGGGCCAGAGTGGTCTTGG - Intergenic
946159232 2:217826031-217826053 GGGCAGGGCCAGGTGGGGCTGGG - Intronic
946374355 2:219299187-219299209 AGGCAGGGCCCATGTGGGCTGGG + Intronic
946921634 2:224585844-224585866 GGGCTGGGCCCCACTGGGCTGGG + Intergenic
948262377 2:236613705-236613727 TGGCCGGTCCATGGTGGGCTAGG + Intergenic
948582366 2:238996865-238996887 GGGCAGGCTCAGCGTGGGCTCGG + Intergenic
948792396 2:240385746-240385768 GGGCAGGGCTAAGCTGGGCTGGG + Intergenic
948869701 2:240791889-240791911 AGGCAGGGCCAGGGTGGGATGGG - Intronic
948869745 2:240792004-240792026 TGGCAGGGCCAGGGTGGGGTGGG - Intronic
949025286 2:241764958-241764980 GGCCAGGGCCAGGGTGTGCTTGG + Intronic
1169287640 20:4322766-4322788 GGGCAGAGCCATAGTGAACTAGG - Intergenic
1171249571 20:23637851-23637873 GGGCCCGGCCATGGTCGGCTAGG + Exonic
1172033409 20:31996471-31996493 GGGCAGGGGCGGGGTGGGCTGGG - Intronic
1172481105 20:35271844-35271866 GGGCCGGGCCAGGGTGGGCATGG + Intronic
1173334356 20:42100911-42100933 GGGCAGGCCCCTAGAGAGCTGGG + Intronic
1173596953 20:44264599-44264621 GGGCAGGGGAAGAGTAGGCTGGG - Intronic
1174080812 20:47969558-47969580 GGGCAGGGCCAAAGTGGGGCAGG + Intergenic
1174180311 20:48670289-48670311 GGGCAGGGGCAGAGAGGGGTTGG - Intronic
1174449245 20:50609548-50609570 GGGCCGGGCCAAGCTGGGCTGGG - Intronic
1175377117 20:58535656-58535678 GGGCAGGGTCCTAGTGTGGTGGG + Intergenic
1175736014 20:61387851-61387873 GGGCGGGGCCAGAGGGGGGTGGG - Intronic
1176098935 20:63356275-63356297 GGGCAGGGCCAGGGTGGGGCAGG + Intronic
1178484261 21:33007363-33007385 GGTCAGGGCAATGGTGTGCTGGG + Intergenic
1179484930 21:41704110-41704132 GGGCGGGGGCATGGTGGGGTGGG - Intergenic
1179988150 21:44932462-44932484 CTGCGGGGCCAGAGTGGGCTGGG + Intergenic
1180950065 22:19716932-19716954 GGTCAGGGCCATGGAAGGCTGGG + Intronic
1181539237 22:23564553-23564575 GGGCCAGGCCATGGTGGGCTTGG - Intergenic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182098679 22:27642660-27642682 GGCCAGGGTCACAGTGGCCTGGG + Intergenic
1182296098 22:29311831-29311853 GGGCAGGGGCAGTGGGGGCTCGG + Intronic
1183346946 22:37313222-37313244 GGGCAGGGCCAGAGTGGGTGAGG - Intronic
1183356284 22:37361506-37361528 GGGCAGGAGCAGGGTGGGCTTGG - Intergenic
1183952025 22:41357547-41357569 GGACAGGGCCTCAGGGGGCTGGG - Exonic
1184096111 22:42317470-42317492 GGGAAGGGCCTAGGTGGGCTTGG - Intronic
1184423113 22:44393137-44393159 GGGCAGGACAGTATTGGGCTGGG + Intergenic
1184569367 22:45312024-45312046 GGCCAGGACCATGCTGGGCTAGG + Intronic
1184767278 22:46578262-46578284 GGGCAGGGCTGCACTGGGCTGGG - Intronic
1184907375 22:47497892-47497914 GGGCAGGGCCTGAGTGGGGAGGG + Intergenic
1185338714 22:50282321-50282343 GGGCAGTGCCTTCGTGGGCTCGG + Intronic
1185338730 22:50282381-50282403 GGTCAGGGCCAGGGTGGGCGGGG - Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
950121669 3:10485910-10485932 GCTCAGGGCCATTGTGGGGTGGG - Intronic
950522355 3:13504788-13504810 GGGCAGGGCCATCCCTGGCTGGG + Exonic
951018256 3:17753520-17753542 TGACTGGGCCAAAGTGGGCTAGG + Intronic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG + Intergenic
954116440 3:48469330-48469352 GGGCAGGGCTAGAGTTGGCAGGG + Intronic
954131080 3:48561229-48561251 GGGCGGGCCTACAGTGGGCTGGG - Intronic
954374154 3:50185408-50185430 GGGCAGGGCCTCAGTGGGGCTGG - Intronic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
954614235 3:51961340-51961362 GGGCAGGGGCAGGGTGGACTGGG - Intronic
954685243 3:52366674-52366696 GAGCAGGGCTAGAGTGGGCTGGG - Intronic
954873673 3:53786718-53786740 GGGCAGGGGCAGAGTGGGGCGGG - Intronic
955829595 3:62986927-62986949 GGGCTGGGGCAGAGTGGGCTAGG - Intergenic
956654343 3:71534656-71534678 GGACAGAGCCAGAGTGGGGTTGG + Intronic
957028212 3:75209216-75209238 GGGCATGCCCATAATGGACTGGG + Intergenic
957955799 3:87185454-87185476 GGGGAGGGACATGGTGGGATTGG - Intergenic
961477920 3:127160061-127160083 GGGCAGGTCCATGGGAGGCTGGG + Intergenic
962384881 3:134924895-134924917 GGACAGGGACATGGTGGGTTAGG + Intronic
963134276 3:141886468-141886490 GAGCAGAGCCATTGTGAGCTGGG - Intronic
965364344 3:167779855-167779877 GGGAAGGGTCACAGTGAGCTGGG + Intronic
966279025 3:178208314-178208336 GGGCAGGGACACAGAGGGTTGGG - Intergenic
966912283 3:184566235-184566257 TGGCAGGGCCACAGTGGGGTGGG + Intronic
967190924 3:186984415-186984437 GGGCAGGGCCTTTGAGGTCTTGG - Intronic
967699057 3:192570233-192570255 GGGGAGGGCCATAGGTGGTTTGG + Intronic
1202738554 3_GL000221v1_random:33544-33566 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969279887 4:6162616-6162638 GGGCAGTGCCACACTGAGCTTGG - Intronic
971957941 4:33446719-33446741 GGGCAGGACCCTAGTGACCTAGG - Intergenic
973370244 4:49240191-49240213 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
973390785 4:49555229-49555251 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
974858543 4:67491563-67491585 GGGATGGGCTATAGTGGGATAGG - Intronic
976186773 4:82449842-82449864 GGGCTGGGCCAGAGTGAGCTGGG - Intronic
976391566 4:84510345-84510367 GGACAGGGCCAGAGTGGTGTGGG + Intergenic
981807055 4:148728775-148728797 TGGGAGGGCCATTGTGGGCCCGG + Intergenic
985271202 4:188196735-188196757 GGTCGGGGCCGTAGTGGGCCAGG - Intergenic
1202767357 4_GL000008v2_random:159707-159729 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
985563617 5:604297-604319 GGGCAAGGCCCAAGAGGGCTGGG + Intergenic
985643290 5:1073686-1073708 GGGCCTGACCATCGTGGGCTCGG - Exonic
985719732 5:1482641-1482663 GGGCAGAGCCGGGGTGGGCTGGG + Intronic
985750797 5:1673171-1673193 GGGGAGGGACATGGAGGGCTGGG + Intergenic
985803515 5:2021673-2021695 AGGGAGAGCCATGGTGGGCTTGG - Intergenic
988597126 5:32605519-32605541 GTGCAAGGCCATGGTGCGCTAGG - Intergenic
988796136 5:34655541-34655563 AGGTCGGGCCTTAGTGGGCTGGG + Intergenic
994533239 5:100993109-100993131 GTGGAGGGCCATAGTGTTCTTGG + Intergenic
995531008 5:113091814-113091836 GGTCAAGGCCATGGTGGGCTAGG + Intronic
996276779 5:121676282-121676304 GGGCTGGGCAATAGTGGGCAGGG - Intergenic
997266454 5:132497717-132497739 TGGCAGGACCTGAGTGGGCTAGG - Intergenic
998104257 5:139458152-139458174 GGTCTGGGTCATTGTGGGCTGGG + Exonic
999235253 5:150086696-150086718 GGGCAGGGCCAGCCTGAGCTTGG + Intronic
1002063889 5:176642826-176642848 GGGCGGGGCCATGGTGCACTGGG - Intronic
1002259929 5:177985828-177985850 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002259937 5:177985858-177985880 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259941 5:177985873-177985895 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259945 5:177985888-177985910 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259961 5:177985961-177985983 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002469791 5:179428548-179428570 GGACAGGGCCCTGGTGGGCCAGG - Intergenic
1002599186 5:180344718-180344740 GGGAAGGGCCATTGTGGCCCTGG - Intronic
1006081755 6:31572055-31572077 GGTCAGGGGAATCGTGGGCTGGG - Exonic
1006180122 6:32149509-32149531 GGGCAGGGGCATACTCGGTTTGG - Intronic
1006725370 6:36196395-36196417 GGGCAGGGCCGTGGTGCGCAGGG + Intergenic
1006943032 6:37765547-37765569 GGGCAGGGCCAGAGAGTGGTAGG - Intergenic
1007590330 6:43017067-43017089 GGGCAGAGTCACAGTGAGCTGGG + Intronic
1007764900 6:44154584-44154606 GGGCAGGGCCCTGGGGGGCGGGG - Intronic
1008604922 6:53131086-53131108 AGGCAGGAGCATGGTGGGCTTGG - Intronic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1009473297 6:64055826-64055848 TGGCAGGGCGATAGTGGGTGTGG + Intronic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1016858442 6:148695037-148695059 TGGCAGGGCCCTAGTGTGCTGGG + Intergenic
1017385900 6:153883053-153883075 AGACAGGGCCATATTGGTCTTGG - Intergenic
1018713555 6:166514583-166514605 GGGCAGGGACATGGGGGCCTGGG + Intronic
1019359864 7:599145-599167 GGCCAGGGCCACACTGTGCTCGG + Intronic
1019569814 7:1705656-1705678 GGGCAGGGCCAGAAAGGGCAAGG - Intronic
1020446207 7:8270803-8270825 GGTCAAGGCTATAGTGAGCTGGG + Intergenic
1022136766 7:27456792-27456814 TGGCAGGGCCAGGGTGGCCTGGG - Intergenic
1023980848 7:45069061-45069083 GGGCTGGGCCCTTGTAGGCTAGG + Intronic
1024784435 7:52890774-52890796 GGGCAGGGGCACAGTGGGGCAGG + Intergenic
1024850905 7:53715995-53716017 GGACAGGGCCATAGGCTGCTAGG - Intergenic
1026767778 7:73171392-73171414 GGGCAGGACCTGGGTGGGCTGGG - Intergenic
1026926373 7:74196657-74196679 TGGCAGGGCCAGGGTGGCCTGGG + Exonic
1027044244 7:74981100-74981122 GGGCAGGACCTGGGTGGGCTGGG - Intronic
1027079397 7:75221258-75221280 GGGCAGGACCTGGGTGGGCTGGG + Intergenic
1027319603 7:77003580-77003602 GGCCAGGGCCATGGAGGGCTGGG + Intergenic
1028046879 7:86131058-86131080 GGGCAGGGCCATGGTGGTTTAGG + Intergenic
1029388621 7:100259841-100259863 GGGCAGGACCTGGGTGGGCTGGG + Intronic
1029570159 7:101363509-101363531 GTGCAGGGCGATTGGGGGCTGGG + Intronic
1031076269 7:117215791-117215813 GGGCAGGGGCAGTGTGTGCTGGG + Intronic
1032196760 7:129793922-129793944 GGGAAGGGCCATGGTGGCCCTGG - Intergenic
1034348464 7:150401402-150401424 GGGCAGGCCCCTCGTGGACTTGG + Intronic
1034529475 7:151686653-151686675 GGGCAGGGCTGGAGTGGGGTGGG - Intronic
1034795965 7:154014009-154014031 GGCCAGGGCAATCCTGGGCTGGG - Intronic
1035256685 7:157633662-157633684 GGGCAGGGCCTGAGTGGGGGTGG + Intronic
1035416406 7:158692236-158692258 GGTCAGGGCTACAGTGAGCTGGG + Intronic
1035714137 8:1740928-1740950 GGGAAGCCCCATGGTGGGCTGGG - Intergenic
1040572842 8:48625156-48625178 GGGCAGGGGCGTCCTGGGCTGGG - Intergenic
1041933650 8:63313433-63313455 GAGCAGTGCCAGGGTGGGCTGGG + Intergenic
1042081538 8:65059693-65059715 GGGCCGGGCCATGGTGGTTTTGG - Intergenic
1043332907 8:79139639-79139661 GGGTAGGGAGATAGAGGGCTAGG + Intergenic
1046499410 8:115056461-115056483 GTGAAGGGCCCTAGTTGGCTTGG - Intergenic
1047226395 8:122958696-122958718 GGGCAGGGCCATAGTGGCTGGGG - Intronic
1047544093 8:125798162-125798184 GGGGAGTGACATAGTGTGCTTGG + Intergenic
1047544545 8:125803053-125803075 GGGCATGGCCATGGTGGGGGAGG + Intergenic
1048328191 8:133454469-133454491 GGCCAGGGCCTGATTGGGCTGGG - Intergenic
1048570639 8:135652492-135652514 GGGCTGGACCACAGTGGGCTGGG - Intronic
1049014223 8:139908238-139908260 GGGCAGGTGCATGGTGGGCCTGG - Intronic
1049228685 8:141470787-141470809 GGGCAGGGCGAAGGTGGTCTTGG + Intergenic
1049510637 8:143025085-143025107 GGGCAGTGCCAGGGCGGGCTGGG + Intergenic
1049672682 8:143876871-143876893 GGGCAGGGCCAGCGAGGGCGGGG + Intronic
1049806846 8:144544962-144544984 GGGACTGGCCATGGTGGGCTTGG + Intronic
1049887442 9:37300-37322 GGGCAGGGCCAAGGGCGGCTTGG + Intergenic
1051170498 9:14315163-14315185 GGGCGGGGCCGTCGGGGGCTGGG - Intronic
1051789364 9:20783083-20783105 GGGCAGGGCAAGAGTTGGCAGGG + Intronic
1052876447 9:33570298-33570320 GGGGAGGGACAGAGTGGGCCAGG + Intronic
1053499560 9:38574046-38574068 GGGGAGGGACAGAGTGGGCCAGG - Intronic
1056587159 9:87936173-87936195 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1056752817 9:89364281-89364303 CAGCAGGGCCATGGTGGGGTGGG - Intronic
1057996986 9:99828054-99828076 GGGAAGGGCTATATTGGGCTTGG - Exonic
1058140776 9:101355035-101355057 GGGCATTGCCATACTGGGGTGGG + Intergenic
1058978982 9:110151857-110151879 GGGCAGGTCCGTATTGGTCTTGG - Intronic
1059724687 9:116995040-116995062 GTGCAGGACCCAAGTGGGCTGGG + Intronic
1060404259 9:123365447-123365469 GGGCAGGGCCATGATGCCCTAGG - Intronic
1060855236 9:126909740-126909762 GGGCAGGGACATAATGAGGTGGG + Intergenic
1061275381 9:129567080-129567102 GGGCCAGGCCGTGGTGGGCTTGG - Intergenic
1061709726 9:132479444-132479466 GGGGAGGGCCTTGGGGGGCTGGG + Intronic
1061854979 9:133437013-133437035 GGGCAGAGTCATAGGGGGGTTGG + Intronic
1061869622 9:133513774-133513796 GGGTGGGGCCAGAGTGGGCTGGG + Intergenic
1061947700 9:133917937-133917959 GGGCCGGGGCTTAGGGGGCTGGG - Intronic
1062004644 9:134233120-134233142 GAGCAGGGCCAGAGTCGGCATGG - Intergenic
1062012048 9:134272670-134272692 GGGCAGGGCCCTGGGAGGCTGGG - Intergenic
1062289746 9:135789214-135789236 AGGCATGGCCACAGCGGGCTTGG + Intronic
1062451070 9:136616072-136616094 GGGCAGGGGCAGAGGGGTCTCGG - Intergenic
1062499761 9:136847392-136847414 GGGCGGGGCCTGAGTGGGCAGGG - Exonic
1062658288 9:137615223-137615245 GGGCAGGTCCTGAGTGGGCCAGG - Exonic
1203707286 Un_KI270742v1:63991-64013 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1203548111 Un_KI270743v1:144579-144601 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1186388112 X:9130579-9130601 GAGCAGGGCCACAGTGAGCTGGG + Intronic
1187076143 X:15937162-15937184 GAGCAGGGTGCTAGTGGGCTGGG + Intergenic
1188694928 X:33178356-33178378 GAGCAGGGCCATGGTGGTCAAGG - Intronic
1189168266 X:38883405-38883427 GGGGAGTGCCATAGAGGGCCAGG - Intergenic
1189322032 X:40092541-40092563 GAGCAGGGCCTCAGTGGGCTGGG - Intronic
1192314933 X:70044029-70044051 GGGCAGGCCCACAGTGGGAATGG - Intronic
1193980408 X:88175539-88175561 GGGCAGTGCCTCAGTAGGCTGGG - Intergenic
1195549036 X:106145344-106145366 GGGCATGGGCACAGTGGGCTTGG + Intergenic
1195702602 X:107716404-107716426 GGGCAGGACCAGACAGGGCTGGG - Intronic
1196998164 X:121407257-121407279 GTGGTGGGCCATAGTGGTCTTGG - Intergenic
1197926472 X:131651960-131651982 GGGAAGGGCAATAGGGGGCTGGG - Intergenic
1198129121 X:133676349-133676371 GTGCATGGCCATGGTGGGCATGG + Intronic
1198312817 X:135437435-135437457 CGCCAGGGCCACAGTGGACTAGG + Intergenic