ID: 1009404896

View in Genome Browser
Species Human (GRCh38)
Location 6:63300139-63300161
Sequence CAGGCAAAGCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 1, 2: 5, 3: 82, 4: 663}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009404896_1009404902 -5 Left 1009404896 6:63300139-63300161 CCTTCCTCCTCCAGCTTTGCCTG 0: 1
1: 1
2: 5
3: 82
4: 663
Right 1009404902 6:63300157-63300179 GCCTGCTGGCCATGCTGAGAGGG No data
1009404896_1009404904 -4 Left 1009404896 6:63300139-63300161 CCTTCCTCCTCCAGCTTTGCCTG 0: 1
1: 1
2: 5
3: 82
4: 663
Right 1009404904 6:63300158-63300180 CCTGCTGGCCATGCTGAGAGGGG 0: 1
1: 0
2: 8
3: 39
4: 323
1009404896_1009404901 -6 Left 1009404896 6:63300139-63300161 CCTTCCTCCTCCAGCTTTGCCTG 0: 1
1: 1
2: 5
3: 82
4: 663
Right 1009404901 6:63300156-63300178 TGCCTGCTGGCCATGCTGAGAGG 0: 1
1: 0
2: 7
3: 42
4: 288
1009404896_1009404905 0 Left 1009404896 6:63300139-63300161 CCTTCCTCCTCCAGCTTTGCCTG 0: 1
1: 1
2: 5
3: 82
4: 663
Right 1009404905 6:63300162-63300184 CTGGCCATGCTGAGAGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009404896 Original CRISPR CAGGCAAAGCTGGAGGAGGA AGG (reversed) Intronic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900241012 1:1617224-1617246 TAGGCACAGCTGGAGGTGCAAGG + Intronic
900501877 1:3009979-3010001 CAGGGAAAGCTGGTTGAAGAAGG + Intergenic
900666406 1:3818195-3818217 CAGGCAGAGTGGGAGGAAGAAGG - Intronic
900746150 1:4362054-4362076 CAGGCACAGCTGGGGGAGAGGGG + Intergenic
900865574 1:5266479-5266501 CAGGCACAGCTTGGGGAGCAGGG - Intergenic
900988558 1:6087073-6087095 GAGCCAAGGCTGGAGGAGGCCGG - Intronic
901012633 1:6210138-6210160 CATGCGAAGCTGGAGGCGGGTGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901430125 1:9209098-9209120 CAGGCACAGATGGAGAAGAAAGG - Intergenic
901462948 1:9402360-9402382 CAGGCAGAGGTGTAGGGGGAAGG - Intergenic
901751728 1:11414211-11414233 CAGACAAAGCAGGGTGAGGAGGG - Intergenic
901751778 1:11414388-11414410 GAGGCAGAGCTGGGGGATGAGGG + Intergenic
902095273 1:13938899-13938921 CAGCTAGAGCTGGAGCAGGAGGG + Intergenic
902607059 1:17574676-17574698 CAGGCAGAGCTATAGCAGGAGGG - Intronic
902640751 1:17764751-17764773 CAGGCAACGCTGGAGGAACGCGG - Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903460005 1:23514258-23514280 GAGGCACAGCAGGAGGAGGATGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904128834 1:28260553-28260575 CAGCCAAAGCTGGGGGGAGAGGG + Intronic
904274046 1:29368962-29368984 CTGTCAAAGCTGGATGGGGAGGG + Intergenic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904599428 1:31665495-31665517 CAGGCCAGGCTGGGGTAGGATGG - Intronic
904613203 1:31736382-31736404 CAGGCAGACCTGGGGGAGCAGGG + Exonic
904914143 1:33957674-33957696 CAGGCAGGGCTGGAGCTGGAAGG + Intronic
904978904 1:34480033-34480055 GGGGCAATGCAGGAGGAGGAGGG + Intergenic
905029014 1:34869024-34869046 CAGGCAGACCTGGAGCTGGAGGG - Exonic
905636948 1:39560194-39560216 CAGGCAAGGCTGGAGCCGCAGGG + Intergenic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906747855 1:48234168-48234190 CAGACACAGCCGGAGGAGCATGG + Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907250810 1:53137815-53137837 CAGTCCAAACTGGAGCAGGAAGG - Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907666235 1:56435978-56436000 CTTGCCAGGCTGGAGGAGGAGGG - Intergenic
907939752 1:59076173-59076195 TACGCAGAGATGGAGGAGGAAGG + Intergenic
908003723 1:59707382-59707404 GAGGCCAAGCTGTAGGAGGAGGG + Intronic
909736291 1:78966647-78966669 CAGGCCCACCTGGAAGAGGAGGG - Intronic
910053473 1:83004151-83004173 CAACCAAACCTGGAGGAAGAAGG + Intergenic
910120342 1:83781675-83781697 CAGGCAAAGAGGGAAGGGGAAGG + Intergenic
910434916 1:87196303-87196325 AATGCAAAGCTGGAGGGGTAGGG - Intergenic
912196174 1:107399889-107399911 CAGGCAGAGATGAAGGAAGAGGG - Intronic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912664665 1:111568327-111568349 AAGGCAAAGCAGGAGCAGGCAGG + Intronic
913163585 1:116166458-116166480 CAGGCACAGCTGGTGGTTGAGGG + Intergenic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
913428869 1:118766774-118766796 AAGGAAAAGGTGGAGGAGCAGGG - Intergenic
913489981 1:119370070-119370092 AAGGCAAAGCTGTAAGAGAAAGG - Intronic
914170205 1:145215893-145215915 GAGGAAGAGGTGGAGGAGGAGGG + Intergenic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
915032630 1:152896723-152896745 TAGACAAAGGTGGAGGGGGAGGG - Intergenic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915287514 1:154862392-154862414 CAGCCAGTGCTGGAGGAGAAAGG + Intronic
915304486 1:154969850-154969872 CAGGCAAAGCTGGAAGGGAAGGG + Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915839396 1:159202665-159202687 GAGGAAAAGCTGGGGGAGGGTGG - Intronic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916394853 1:164374723-164374745 TAGCCACATCTGGAGGAGGAAGG - Intergenic
916852551 1:168718472-168718494 AAACCAAAGCCGGAGGAGGAGGG - Intronic
917142417 1:171850046-171850068 CAGGCAAAGATGGTGTAGAAGGG + Intronic
917325117 1:173824291-173824313 CAGGCTCAGCTGGAGAGGGACGG - Exonic
917427285 1:174928083-174928105 CCTGCAAGGCTGGAGAAGGAAGG - Intronic
917740585 1:177958415-177958437 CAGCCCCAGCTGGAGAAGGAAGG + Intronic
917927875 1:179803979-179804001 CAGGCCAGGCGGCAGGAGGAGGG + Intronic
917964556 1:180170090-180170112 GAGGCAGAGCTGGGGGAGGAGGG + Intronic
918045580 1:180939100-180939122 CAGGCAGAGCTGGGGGGAGAAGG + Intronic
919495181 1:198256314-198256336 CAGGCAAACCTGCAGGAAAATGG - Intronic
919611999 1:199756946-199756968 CAAACAAAGCAGGAGGAAGAAGG - Intergenic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920691545 1:208150664-208150686 CAGACAAGGGTGGATGAGGATGG + Intronic
920963027 1:210680953-210680975 CAGGCAGAGCTGGAGGGAAATGG + Exonic
921127570 1:212190992-212191014 CAGCGAAAGCTGGATGAGAAGGG + Intergenic
921380907 1:214523742-214523764 CAGCCACCGCAGGAGGAGGAGGG - Intronic
921760218 1:218904694-218904716 AATTCAAATCTGGAGGAGGAAGG - Intergenic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922323291 1:224506395-224506417 AAGCCAAGGCTGAAGGAGGAAGG - Intronic
922562902 1:226582017-226582039 GAGGGAGAGCTGGAAGAGGAGGG - Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923441927 1:234028704-234028726 CTGGCAAAGCTACAGGAGGTGGG + Intronic
923771421 1:236941158-236941180 CAGGTAAAGCTGGAGGAAGTGGG + Intergenic
924394650 1:243606248-243606270 CAGGCAAGGCTGGAACAGTATGG + Intronic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1064698573 10:17993167-17993189 CAGGCCCTGCTGGATGAGGATGG - Exonic
1064904049 10:20325950-20325972 AAGGCAAAGCTGGGCCAGGAAGG + Intergenic
1065068927 10:22002902-22002924 CCAGCACAGCTGGAGGGGGAAGG + Intronic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065421317 10:25547470-25547492 CAGGCAAAGATGAAAGAGGGAGG - Intronic
1065586554 10:27224124-27224146 AGGCCAAAGCAGGAGGAGGATGG + Intronic
1066330004 10:34411143-34411165 CAGACAGAGATGGGGGAGGAGGG + Intronic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067217166 10:44312768-44312790 CAGGCACAGCCTGAGGAGGTGGG - Intergenic
1067232587 10:44422590-44422612 CTGTCAAAGCTGGAAGATGAAGG - Intergenic
1067324013 10:45249181-45249203 CAGGAAGAGCTGCAGGAGCAGGG - Intergenic
1067944945 10:50683486-50683508 GAGGCAGAGAGGGAGGAGGACGG - Intergenic
1068404379 10:56570687-56570709 CAGCCACAGCTGGAGGTGGAGGG + Intergenic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1070705804 10:78637312-78637334 GAGGCAAAGATGTAGGATGATGG - Intergenic
1070866446 10:79710357-79710379 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1070880239 10:79848488-79848510 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1070943208 10:80365602-80365624 CAGGCAAAGATTGAAGTGGAGGG + Intronic
1070982415 10:80660216-80660238 CAGCCAGGGCTGGAGAAGGAGGG - Intergenic
1071411413 10:85400454-85400476 CACACAAAGCTGGTGGAGTATGG + Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071633356 10:87232578-87232600 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1071646805 10:87364796-87364818 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1072215431 10:93283673-93283695 CAGGCATGGCGGGAGAAGGAAGG + Intergenic
1072460121 10:95611061-95611083 TTGTCACAGCTGGAGGAGGAGGG - Intronic
1072554420 10:96503929-96503951 CAGGCAAAGCTGGAGGCCCCAGG + Intronic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073100972 10:101006539-101006561 CAGGCAGAGCTGGTGCAGAAGGG + Exonic
1073199523 10:101723838-101723860 GAGGGAAAGCTGGGGCAGGATGG - Intergenic
1073250000 10:102115281-102115303 CTGGCAGAGATGGAGGAGGGCGG + Intronic
1073433015 10:103499139-103499161 CAGCCAGAGCTGGAGGGGGACGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074160704 10:110834271-110834293 CAGGCAAAGCTGCTGATGGAGGG - Intronic
1074345461 10:112681182-112681204 GAGGCTAAGGTGGAGGTGGAAGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074706272 10:116134985-116135007 AAGGAAAAGGTGGAGGAGGTTGG - Intronic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1075005921 10:118830092-118830114 CAAGCAGAGCTGGATGAGGATGG - Intergenic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1075924515 10:126239976-126239998 CACGGAAGGATGGAGGAGGAGGG - Intronic
1075970921 10:126651700-126651722 CAGGCAAAGTTAGTGGGGGAGGG - Intronic
1076301196 10:129427782-129427804 TGAGCAATGCTGGAGGAGGATGG + Intergenic
1076323714 10:129604147-129604169 CATGCAAACAAGGAGGAGGATGG - Intronic
1076342758 10:129760815-129760837 CAGGAAGAGATGGAGGAGGTGGG - Intronic
1076769725 10:132656438-132656460 CAGGCACAGCTGGCGGGGGCAGG - Intronic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077230418 11:1456032-1456054 AGGGCAAAGATGGAGGTGGAAGG - Intronic
1077234870 11:1476084-1476106 GAGGCACACCTGGAGCAGGACGG + Intronic
1077283471 11:1755825-1755847 GAGGCAAAGGCGGAGGAGGCTGG - Intronic
1077485732 11:2837646-2837668 CAGCCAAACCAGGAGGGGGAAGG + Intronic
1078194558 11:9124745-9124767 GATCCAAAGCTGGAGGAGGTTGG + Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078456839 11:11482249-11482271 CTGGCACAGCTGGGGGAGGATGG - Intronic
1080882395 11:36334556-36334578 CAGGCAAAGAGGGAGGGGAAAGG - Intronic
1080886962 11:36376495-36376517 AGGGCAGAGCTGGGGGAGGAGGG + Intronic
1081565899 11:44261144-44261166 CAGGCCTAGCTGGGGGAGGATGG - Exonic
1081848022 11:46254393-46254415 CAGGCAGGGCTGGAAGGGGAGGG - Intergenic
1081968937 11:47185576-47185598 CAGCCAAAGCGGGAGGAGGCAGG + Intronic
1082162419 11:48900303-48900325 CAGGCCAAGGTGCAGGAGAAGGG - Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082868447 11:57920781-57920803 CAGGCAAAGTTGTGGTAGGAAGG - Intergenic
1082975715 11:59069930-59069952 TAGGCAAACCTGGCGGATGAAGG + Intergenic
1082980096 11:59113345-59113367 TAGGCAAACCTGGTGGATGAAGG + Intronic
1082998084 11:59268444-59268466 GAGGCAAAGCTGGTGCAGCAGGG + Intergenic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1083162692 11:60865038-60865060 AGAGCAGAGCTGGAGGAGGAGGG - Intergenic
1083314044 11:61803176-61803198 CAGGTAAAGCTGGCTGAGGAAGG + Intronic
1083314194 11:61804215-61804237 CAGGCAGAGGTGGAGCAGGGGGG - Intronic
1083738084 11:64693166-64693188 CAGGCAGAACTGGAGGAAGGAGG + Intronic
1083750551 11:64758507-64758529 CAGGCCCAGCTGGAGGAGTGAGG + Exonic
1083820172 11:65165959-65165981 CAAGAAAAGCTGGGGAAGGAGGG - Intergenic
1083895867 11:65619474-65619496 CAGACAAGGCTGGGGGAGTAAGG - Intronic
1084005843 11:66323082-66323104 CAGGCAAAGCAGGAGAAGAAAGG + Intergenic
1084265815 11:68004594-68004616 CAGCCCAAACTGGAGCAGGATGG - Intronic
1084266897 11:68009826-68009848 CAGGCAAGGTGGTAGGAGGAGGG + Intronic
1084659776 11:70539974-70539996 CAGGCGAAGATGGAGGCAGAGGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1085295396 11:75428779-75428801 CAGGCAAAGTTGGAAGTGGCAGG - Intronic
1085875265 11:80399604-80399626 GAGGTAAAGCTGACGGAGGAGGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088909754 11:114181897-114181919 CAGGCAAGGCAAGAGGAGCAAGG - Intronic
1088991785 11:114960383-114960405 GAGGCAGGGCTGGAGGAGGGAGG + Intergenic
1089170535 11:116508406-116508428 CAGGTAAAGATGAAGGAGAAAGG - Intergenic
1089220110 11:116863629-116863651 CAGGCATCCCTGGAGGAGCATGG - Intronic
1089257756 11:117202973-117202995 CAGGCCAGGGTGGAGGAGGGAGG - Exonic
1089380906 11:118030752-118030774 GAGCCAAAGCAGGATGAGGAGGG + Intergenic
1089400312 11:118160636-118160658 CAGGCCAAGCTGGGGAGGGAAGG + Intergenic
1089498156 11:118918154-118918176 TAGGGAAAGCTGGAGGAAGCTGG - Intronic
1089767917 11:120781964-120781986 CATGCCAAGTTGGAGGAGAAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090480827 11:127066777-127066799 GAGGCAGAGCAGGAGGAAGATGG + Intergenic
1090925728 11:131248773-131248795 CAGGGAAAGGTGGAATAGGAAGG - Intergenic
1091078673 11:132645057-132645079 CAGGCAGAGCTGGAAGTGCAGGG - Intronic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091406483 12:212806-212828 CAGCCGAAGCTGGAGGTGGAAGG - Intronic
1091990486 12:4951590-4951612 CAGGCAAAGCTGGAAGAGTTTGG + Intergenic
1092009310 12:5096396-5096418 CAGGCAAGCCTGGAGGAGAGAGG + Intergenic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092184120 12:6466220-6466242 CAGGCACAAGTGGAGGAGGTAGG - Exonic
1092428587 12:8392068-8392090 TAGGGAGAGCTGGAGGAGGGAGG - Intergenic
1092429669 12:8398212-8398234 TAGGGAGAGCTGGAGGAGGGAGG - Intergenic
1092722164 12:11451999-11452021 GAGGCAAGGCTGGGGGAGGACGG - Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1095948430 12:47767063-47767085 AAGGCGAAGCTGCAGGAGGGGGG + Intronic
1095999731 12:48119288-48119310 GAGGCAAAGAGGGAGGGGGAAGG - Intronic
1096487948 12:51996296-51996318 CTGCCAAAGCTTGTGGAGGAGGG + Intronic
1096686869 12:53293812-53293834 CAGACAAATCTGGAGGAGAAAGG + Intergenic
1097007746 12:55931342-55931364 CAGGTAAAGTGGGAGGATGAGGG + Exonic
1099024386 12:77447551-77447573 CAGCCACTGCTGGAGGATGAGGG - Intergenic
1100354313 12:93814668-93814690 CAGGCGAAGCTGGAGAATGCAGG - Intronic
1100787866 12:98097670-98097692 CAGGCAAAAATGGAGGGGGAAGG - Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1103376205 12:120457986-120458008 CATTCAAAGCAGGAGGAGCATGG + Intronic
1103394818 12:120599426-120599448 CCAGCAATGCTGGAGGAAGAGGG - Intergenic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1104245618 12:127038317-127038339 CAGACACAGCTTGGGGAGGAGGG - Intergenic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104856725 12:131905643-131905665 CAGGCTGGGCTGGAGGAGCAAGG - Intronic
1105279135 13:18953056-18953078 CAGTCAAGGTTGGAGGAGGGCGG + Intergenic
1105402242 13:20105876-20105898 CAGCCCCAGCTGGAGGAGGCTGG - Intergenic
1106100882 13:26694562-26694584 CATGCTAAGCTGGAGGACGGGGG + Intergenic
1106394514 13:29367244-29367266 CAGGCAAAGGTGGAGGAATTGGG + Intronic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1108245110 13:48506167-48506189 CAGGCAGAGCTGGAGACGGCAGG + Intronic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1112547965 13:100389971-100389993 GAGGCAAGACTGGAGGAAGAGGG + Intronic
1112805167 13:103156786-103156808 CAGGCAAAGCTGGGGCAGGGTGG - Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113127860 13:107000222-107000244 CAGCAAGAGCTGGAGGAGAAGGG - Intergenic
1114617025 14:24073711-24073733 GAGGCAAAGCTGATGGAGGTAGG - Intronic
1115564468 14:34613171-34613193 CACTGAAAGCTGGAGGAGGCAGG + Intronic
1117315622 14:54568029-54568051 CAGGCAGAGCTGGAGGAAGCGGG - Exonic
1117967638 14:61221807-61221829 CTGACAAAGCTGCAGCAGGAAGG - Intronic
1118049702 14:62013628-62013650 CAGGTAAAGTTGAAGGAGGTGGG - Intronic
1118727109 14:68636825-68636847 CTGGCAAAGCAGGAGGACGGCGG + Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1119037457 14:71242396-71242418 CAAGGAAAGCTGGGTGAGGAGGG - Intergenic
1119730571 14:76948486-76948508 AAGGAAAAGGTGGAGGAGGGTGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121080051 14:91100579-91100601 CTTGCAAAGCTGGATGAGGCTGG + Intronic
1121148583 14:91608122-91608144 CAGGAATAGCTGTAAGAGGAGGG + Intronic
1121622982 14:95363065-95363087 CAGGGAAGGTTGGATGAGGACGG - Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122804732 14:104250604-104250626 CTGGTAAAGGTGGAGGGGGAGGG + Intergenic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1124103123 15:26713635-26713657 CAGGCAATGCTGGCACAGGAAGG + Intronic
1124244551 15:28058203-28058225 AAGGCAAAACTGCAGCAGGAGGG + Intronic
1124558724 15:30751019-30751041 CATGAAAAGCTGGAGGATGAAGG - Intronic
1124672534 15:31654724-31654746 CGTGAAAAGCTGGAGGATGAAGG + Intronic
1124700116 15:31905330-31905352 CAGGCGACGCTGGAGTGGGAAGG - Intergenic
1125358793 15:38844442-38844464 GAGGCAGAGATGGAGGGGGAAGG - Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126500648 15:49340410-49340432 GAGGCAAAGCGGGGGGGGGAGGG - Intronic
1127642508 15:60929265-60929287 GAGGGAGGGCTGGAGGAGGAGGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1127966799 15:63928779-63928801 CAGGCAAAGAGGAAGGAGAAAGG + Intronic
1128038447 15:64547871-64547893 GAGGCAAAGCAGGAGGACGGGGG + Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128629722 15:69252369-69252391 AAGGCAAAGCTGGAGCAAGCAGG + Intronic
1128987259 15:72230668-72230690 CACGCACAGCTTGAAGAGGAGGG + Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129426737 15:75468935-75468957 CTGGCACAGCTGGAGGAGCTTGG - Exonic
1129602434 15:77008067-77008089 CAAGCAGAGCTGGGGGTGGAGGG + Intronic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130461390 15:84160086-84160108 CAGGCAAGGCAGGAGGTGGCCGG - Intergenic
1130956570 15:88631014-88631036 CAGGCACAGCTCAGGGAGGAGGG + Exonic
1131809501 15:96158172-96158194 CAAGGAAAGCTGGAGGAGAAAGG + Intergenic
1132093972 15:98968545-98968567 CAGGAAATGCTGGAAGAGGTGGG - Exonic
1132143775 15:99414975-99414997 CAAGGAAACCTGGAGGAGGTGGG - Intergenic
1132479127 16:157841-157863 AAGACAAAGATGGAGAAGGAAGG + Intronic
1132584189 16:699188-699210 CGGGCAGAGCTGGCTGAGGAAGG + Intronic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133127128 16:3654360-3654382 CAGGCAACTCTGCAGGAGGCTGG - Intronic
1133485379 16:6214573-6214595 GAGGCAAAGTGGGAGAAGGAGGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134142299 16:11731363-11731385 CAGGCACAACTGGAGGGGAAAGG - Intronic
1134273243 16:12753572-12753594 TAGTCAGACCTGGAGGAGGAGGG - Intronic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135861301 16:26058491-26058513 CAGGCACAGCAGGAGGTGAACGG + Intronic
1135963652 16:27018354-27018376 CAGGCAAAGCTAAAGGAAGAAGG + Intergenic
1136081319 16:27854251-27854273 AAGGCAAAAGGGGAGGAGGAGGG + Intronic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136381475 16:29898066-29898088 CAGGCCCAGCTGATGGAGGAGGG - Intronic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1136631128 16:31489864-31489886 CTGACAAAGCTGGGGGAGCAAGG + Exonic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137676022 16:50304274-50304296 CAGGGAGAGCTGGATGGGGATGG + Intronic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1138967551 16:62103339-62103361 CAGGCACAGAGGGAGGTGGAGGG - Intergenic
1139377583 16:66509822-66509844 CAGGCAGAGCTGGTGGGGGCAGG - Exonic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139599010 16:67975532-67975554 CAGTCAAAGCTGGAGGTGAGTGG + Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1140041932 16:71413861-71413883 CAGGCAGTGCAGGAGGAGGGTGG + Intergenic
1140451672 16:75075732-75075754 GCAGCAAAGGTGGAGGAGGAGGG + Intronic
1141306745 16:82871781-82871803 AAAGCAAAGCTGGGGGATGAAGG - Intronic
1141461707 16:84181767-84181789 CAGGCAATGCAGGTGGAGAAAGG - Exonic
1141503330 16:84459580-84459602 CCGGCAGAGCTGGGTGAGGATGG + Exonic
1141740991 16:85892865-85892887 CAGTGAAGGCTGGAGTAGGAAGG + Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1142157450 16:88539140-88539162 CAGGCAAAGCTGGGGGGAGTGGG - Intergenic
1142240446 16:88942179-88942201 AAGGCAAAGCGGGCGGGGGAGGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1143110235 17:4548794-4548816 CGGGCAAGGCTGGAGGGGGCTGG + Intronic
1143241208 17:5444691-5444713 AAGGCCCAGCTGGAGGAGCACGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143742611 17:8965523-8965545 CAGGCAGAGCTGGAGCAAGCTGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1146669007 17:34724022-34724044 CAGGCTGAGCTGGAGCAGGCTGG + Intergenic
1147134921 17:38428951-38428973 CCGGCACAGCTGGAGGGAGAGGG + Intronic
1147448673 17:40490383-40490405 CCAGCAAAGCTGGAGGAAGGTGG + Intronic
1147553306 17:41460369-41460391 CAGGCAAAGATGGCGGAGGTTGG - Intronic
1147887800 17:43696454-43696476 CAGGCAAAGCTTCAGGGAGAGGG - Intergenic
1147904926 17:43816491-43816513 CAGGCAAAGCTGGTGGGGACAGG - Intronic
1148051173 17:44770545-44770567 GAGGCAGAGCTGGAGCGGGAGGG + Intronic
1148128521 17:45248758-45248780 GGGGCAAGGCTGGTGGAGGAGGG - Intergenic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148615408 17:48997101-48997123 CAGCCCAAACTGGGGGAGGATGG - Intergenic
1148697964 17:49572460-49572482 CAGGGAAGGCTGGAGGCAGAGGG + Intergenic
1148864018 17:50619232-50619254 CAGACCAGGCTGGAGGAGCAGGG - Intronic
1148894179 17:50830570-50830592 AAGGCAAAGCTGGAGGAGTCAGG + Intergenic
1149064647 17:52465629-52465651 CAGCCACAGCTGGAGGAGTTGGG - Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1150049695 17:61949335-61949357 CATGAAAAGCTGGGGCAGGAGGG - Intronic
1151648982 17:75453968-75453990 CATGTAAGGCTGGAGGGGGAGGG + Intronic
1151745625 17:76010257-76010279 AAGGCCCAGGTGGAGGAGGAGGG - Exonic
1151827228 17:76530198-76530220 GAGGCAGGGCTGGAGTAGGAAGG - Intronic
1151968760 17:77446235-77446257 CACCCAAAGCTGGAAGAGGCAGG - Intronic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152259376 17:79258801-79258823 TCGGCAGAGCAGGAGGAGGATGG - Intronic
1152307092 17:79527503-79527525 GAGACAAAGCTGGTGGGGGAGGG - Intergenic
1152428243 17:80230572-80230594 CAGGCCAGGCTGGTGGAGGAAGG + Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1152730576 17:81967721-81967743 CCTCCAAAGCTGGGGGAGGAAGG + Intergenic
1152797704 17:82316225-82316247 CAGGCCCAGCCCGAGGAGGAAGG + Exonic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1154490354 18:14917387-14917409 AAGGGAAAGATGGAAGAGGAAGG - Intergenic
1155570373 18:27185445-27185467 AAGGCAGAGCTGGAGAAGGCAGG - Intergenic
1156072650 18:33231629-33231651 CAGGCAGAGCTGCAGCAGCAAGG + Intronic
1156683999 18:39622328-39622350 CAGCCAAGGCTGGGTGAGGAAGG - Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1160970154 19:1764423-1764445 CGGGGAAAGCTGGAGGGAGAGGG + Intronic
1161339905 19:3735703-3735725 CAGGCAGAGCTGGGGGAGGTTGG + Intronic
1161988097 19:7668936-7668958 CAGTAAGGGCTGGAGGAGGAAGG - Intergenic
1162043588 19:7984816-7984838 GAGGCAAAGGTGGAGGTGGGTGG - Intronic
1162315908 19:9937702-9937724 TAGGCAGAGGTGGAGGAGGGGGG + Intergenic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1163055595 19:14715368-14715390 CAGGCACAGCTAGGGGAGAAGGG - Exonic
1163130091 19:15266921-15266943 CAGGCAGAGATGGATGAGGAGGG + Intronic
1163210855 19:15839050-15839072 CAGGCAAGACTGGAACAGGAGGG + Intergenic
1163250496 19:16123890-16123912 CAGGAAAACCTGGAATAGGATGG + Intronic
1163576866 19:18115967-18115989 CAGCCAGAAATGGAGGAGGAAGG - Intronic
1163815486 19:19462398-19462420 CAGGCACAGCTGGAGGGGGTGGG - Intronic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1165138025 19:33682981-33683003 AAGGCAAAGTGGGAGGAGGCCGG + Intronic
1165330805 19:35140323-35140345 CAGGCAAAGATGGGGTGGGATGG + Intronic
1165445887 19:35856645-35856667 CAGGCAAGGGGTGAGGAGGAGGG - Intronic
1165789441 19:38482838-38482860 CTGGGAAAGTTGGAGGAGGTTGG + Intronic
1165930781 19:39357006-39357028 CAGGCAGAGCTGCAGGAAGCGGG - Exonic
1166288150 19:41845145-41845167 CCGGCTAAGAGGGAGGAGGACGG - Intronic
1166937057 19:46340264-46340286 CAGGCAAAGCTGGGGGCGGCAGG - Exonic
1167661800 19:50799665-50799687 CAGGCTGAGCTGGATGGGGAGGG - Intronic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168216764 19:54931882-54931904 CAGGCAGAGCTGGAAATGGATGG - Intronic
925423375 2:3729304-3729326 CAGGCAGAACTGGAGAAGAAGGG + Intronic
925635124 2:5935181-5935203 AAGGCAAAGCTGGAACAGCATGG + Intergenic
926115635 2:10211386-10211408 CAGGCAAGCCGAGAGGAGGACGG + Exonic
926163116 2:10501934-10501956 GAGGAAAGGCTGGTGGAGGAGGG - Intergenic
926163296 2:10502790-10502812 CTTGCAGAGCTGTAGGAGGAGGG - Intergenic
926765986 2:16323090-16323112 CAGTCAGAGTTGGTGGAGGAAGG - Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927139149 2:20118066-20118088 CAGGAGCAGCTGGAGGAGCAGGG + Intergenic
927193794 2:20534246-20534268 CAAACACAGCTGGAGGAGGTTGG + Intergenic
927471974 2:23384191-23384213 CAGACAGGGGTGGAGGAGGAGGG + Intergenic
927848048 2:26481411-26481433 CAGGCAGAGATGGAGAGGGATGG - Intronic
927900612 2:26815744-26815766 CAGGCAGAGCGGGAGGCGGGGGG + Intergenic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928261394 2:29770140-29770162 CAGGCACAGTTAGAGGAGGAGGG + Intronic
929403722 2:41615477-41615499 CAGGCAGGTATGGAGGAGGATGG - Intergenic
930215716 2:48694803-48694825 GAGGGAAAGATGGAGGAGTAGGG - Intronic
931091171 2:58888012-58888034 CAGCCAAAGGTGGAGAAGCATGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931550260 2:63436939-63436961 CAGTTATAGCTGGAGGGGGAGGG + Intronic
932435208 2:71699328-71699350 CAGCCCCAGCTGGGGGAGGAGGG - Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935469646 2:103442965-103442987 CACTAAAGGCTGGAGGAGGAAGG + Intergenic
935514931 2:104024041-104024063 CAGGGAATGATGGAGGTGGAGGG + Intergenic
936054806 2:109254487-109254509 GAGGCAAAGCTGAACGAGGCTGG - Intronic
936067231 2:109341854-109341876 CAGGCAAGGCTGGAAAATGAAGG + Intronic
936093564 2:109515772-109515794 GAGGCAAAAGTGGAGCAGGAGGG + Intergenic
936370072 2:111896533-111896555 CAGGCAGATATGGAGGAGCAAGG + Intergenic
936451201 2:112635223-112635245 CAGGCAAAGAGGGAGGACAATGG + Intergenic
937456263 2:122044269-122044291 CAGGCAGTGCTGCAAGAGGATGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938805402 2:134802525-134802547 CAGGCATATCTGTAGGATGAGGG - Intergenic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
941459426 2:165750941-165750963 CAGGCAAAGCCAAAGAAGGAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945050741 2:205821913-205821935 CAAGCTCAGCTGGAGGAGGAAGG + Intergenic
945272618 2:207956899-207956921 CAAGAAAAGCTGGAAGGGGAGGG + Intronic
946169736 2:217887739-217887761 CACACAAAGCTGGAAGTGGATGG + Intronic
946176031 2:217922460-217922482 CAGGCCAAGCTGCCAGAGGACGG + Intronic
946239787 2:218346486-218346508 CAGACAAGGCAGGAGGAGCAGGG - Exonic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947383790 2:229570773-229570795 GAGGCAAAGCAGGTGGGGGAGGG + Intronic
948063839 2:235062023-235062045 CAGACAGAGATGGAGGAGGGAGG + Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
948858015 2:240739515-240739537 CAGTCAACCCTGGAGCAGGATGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
949043259 2:241858989-241859011 GAGGCAGTGCTGGGGGAGGAGGG + Intergenic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1169787628 20:9377007-9377029 CAGGCAAAGAGAGAGAAGGAGGG + Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170970980 20:21116376-21116398 GAGGCAAAGAGGGAGCAGGATGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1171964301 20:31517628-31517650 CAGGCAGAGCAGGAGAAGGTGGG + Intronic
1172125856 20:32624822-32624844 CAGGCCAAGCTGGAACAGGAAGG - Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172389007 20:34553453-34553475 GAGGCCAACGTGGAGGAGGAGGG - Intronic
1172625963 20:36347036-36347058 CAGGCAAAGCTTCAGGAAGGAGG - Intronic
1173342049 20:42161602-42161624 CAGGCCAAGCTGGGGGAGACAGG - Intronic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174388115 20:50198667-50198689 GAGGCAAGGCTGGAGAGGGAGGG + Intergenic
1174832720 20:53827786-53827808 GAGACAAAGAGGGAGGAGGATGG - Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175225872 20:57443501-57443523 CCTGCAAAGCTGGAGAAGCAGGG + Intergenic
1175768701 20:61609023-61609045 CAGGAAAAGATGGAGGAGCTGGG - Intronic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1175871255 20:62210493-62210515 CAGGCAGGGCTGGAGGTGGCCGG - Intergenic
1176115128 20:63428863-63428885 CTGCCAAAGCTGGAGGAGTTGGG + Intronic
1176233146 20:64042121-64042143 CAGCCACAGCTGGAGCAGGGGGG - Intronic
1176885170 21:14246554-14246576 CAGGCCAAGTTGTATGAGGAGGG - Intergenic
1177467341 21:21503608-21503630 AATGCAAAACTGGATGAGGAGGG + Intronic
1179928355 21:44550713-44550735 GAGGAAAAGCTGCAGGAGGCTGG + Exonic
1180057616 21:45367048-45367070 CAGGCCCAGCTGGCGGGGGAGGG + Intergenic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180222765 21:46369934-46369956 CAGGCGGAGCTGGAGGAGCCGGG + Intronic
1180618394 22:17143746-17143768 CAGAAAGCGCTGGAGGAGGAAGG + Intronic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1181861533 22:25823053-25823075 TAGGCAAGGTTGGGGGAGGAGGG + Intronic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182934775 22:34210630-34210652 TGGGCAAAGCTGGTGGGGGATGG + Intergenic
1183217904 22:36493065-36493087 AAGACAGAGCTGGAGCAGGATGG - Intronic
1183334215 22:37237382-37237404 CAGGGAGAGGTGGAGCAGGAGGG + Intronic
1183408054 22:37640017-37640039 CGGGCAGAGCTGGAGGAGCAAGG + Intronic
1183465952 22:37980532-37980554 CCGGCACAGCTGGTGGAGGAGGG - Intronic
1183520833 22:38295251-38295273 CAGGCAAAGCTGGAGCAGAAGGG + Intronic
1184108971 22:42384162-42384184 CAGATAAAGATAGAGGAGGAGGG + Exonic
1184161717 22:42701075-42701097 CAGGCAAGGGTGGAGGTGGGTGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184697700 22:46149471-46149493 CAGGCACAGCTGGCAGCGGAGGG + Intergenic
1184951186 22:47843646-47843668 GAGGCACCCCTGGAGGAGGACGG + Intergenic
1185081675 22:48712845-48712867 CTCTCAGAGCTGGAGGAGGAGGG + Intronic
1185295200 22:50049665-50049687 CAGGCAGGGGTGGAGGAGGAGGG + Intronic
1185323100 22:50210848-50210870 CAGGTGGAGCTGGAGGAAGACGG + Exonic
950102570 3:10367042-10367064 CAGGCACGGGTGGAGGAGGGTGG - Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950529615 3:13545665-13545687 GGGACAAAGCTGGAAGAGGAAGG + Intergenic
951340382 3:21478880-21478902 CAGGAAAATTTGGAGGAGAAGGG + Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952537278 3:34324122-34324144 GAGGCAAAGCTATAGAAGGAAGG + Intergenic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
952960193 3:38584192-38584214 CAGGCAATGCTGAAGAGGGAAGG - Intronic
953041453 3:39258163-39258185 CTGGCACAGCTGCAGGAAGATGG + Intergenic
953878278 3:46678709-46678731 CAGGCAACGCCTGAGGAGGGCGG + Intronic
954462179 3:50633636-50633658 ATGGCAAGGCTGGAGGAGGAAGG - Intronic
954720166 3:52554748-52554770 CAGGCACACCTGGCGGAAGATGG + Exonic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955355139 3:58224954-58224976 CAGGCAAAGCTAGAAGGAGAAGG - Intergenic
955763603 3:62316760-62316782 CACAAAAAGCTGGAGGATGATGG - Intergenic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956060615 3:65344661-65344683 GATGCAAAGTTGGAGGAGGCAGG - Intergenic
956510993 3:69993330-69993352 CATGCAAGACTGGAGGAGGATGG + Intergenic
956915871 3:73870202-73870224 CAGGCAAAGGTGGCTGAGGATGG + Intergenic
957507713 3:81145755-81145777 CAGGCAGTGTTGGGGGAGGAAGG + Intergenic
958616054 3:96494430-96494452 GAGGCAGGGCTGAAGGAGGAGGG - Intergenic
958755333 3:98244891-98244913 CAGGCTAAGGTGGAAGAGGGAGG - Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960569565 3:119172558-119172580 CAGGAAACTCTGGAGGAAGATGG - Intronic
961015729 3:123466757-123466779 CAAGCCCAGCTGGAGAAGGAAGG - Intergenic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
961761227 3:129169580-129169602 CCAATAAAGCTGGAGGAGGAAGG - Intronic
962346083 3:134619878-134619900 CAGGCACAGCTGGTGGAGTTGGG + Intronic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
964553259 3:157908689-157908711 CAGGAAAAATTGGAGGTGGAGGG + Intergenic
965632786 3:170750434-170750456 CATGCCAAGATGGAGCAGGAAGG - Intronic
966346085 3:178981659-178981681 CAGGCAAAGCTGGAATGGGTGGG + Intergenic
966805370 3:183803624-183803646 TAGGGAAAGCTGGGGTAGGAGGG + Intronic
966805390 3:183803712-183803734 TAGGGAAAGCTGGGGTAGGAGGG + Intronic
966984975 3:185171928-185171950 CATCCCAAGCTGGAGAAGGAGGG - Intergenic
967728084 3:192880536-192880558 CAGGCAAGGTTGGAGTATGAAGG - Intronic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
972679212 4:41289469-41289491 CAGGTAGTGGTGGAGGAGGAGGG - Intergenic
974225089 4:59031581-59031603 CAAGCAAAGCTTTAGCAGGAGGG - Intergenic
974475983 4:62380918-62380940 CAGGAAAATCTGGAGAAAGAAGG + Intergenic
975457844 4:74613793-74613815 TGGTCAAAACTGGAGGAGGATGG - Intergenic
976205296 4:82618515-82618537 CAGGCAATGCTGGAGAAAGGGGG - Intergenic
976890416 4:90039766-90039788 CAGACAAAGAGAGAGGAGGAAGG - Intergenic
977205247 4:94158613-94158635 AAGACAAAGCAGGAGGAAGAAGG - Intergenic
977227859 4:94414679-94414701 CAGGCAAATGTGCAAGAGGAGGG - Intergenic
977264149 4:94834423-94834445 TATGCAAAGCTGGAGGAGGAGGG - Intronic
977347136 4:95830281-95830303 CAGGCAATGCTTGACCAGGAGGG - Intergenic
978555310 4:109973391-109973413 CAGGCAAAGGTGGGTGGGGATGG - Intronic
979631057 4:122903677-122903699 ACTGCAAGGCTGGAGGAGGAAGG + Intronic
982100729 4:151965270-151965292 CAGGCAGAGCTGGATGGAGAAGG - Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984984409 4:185314015-185314037 TAGGCAGAGCAGGAGGAAGAGGG + Intronic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985761422 5:1751226-1751248 CAGTCAAGGCTGGAGGTGGTAGG - Intergenic
985802157 5:2011704-2011726 CAGCCAGGGCTGCAGGAGGAGGG - Intergenic
986026689 5:3857992-3858014 GAGGCAAGGCTGGGCGAGGATGG + Intergenic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989532538 5:42524787-42524809 CAGCCACAGCTGGAGCAGGTGGG - Intronic
990443528 5:55870549-55870571 AAGGGAAAGATGGAGGAAGAGGG - Intronic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993082812 5:83322760-83322782 CACAAAAAGCTGGAAGAGGAAGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994194713 5:96909615-96909637 CAGGCAAAGCTGGAGTGACAAGG + Exonic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
996201364 5:120678363-120678385 CATGGAAAGCTGGGGTAGGATGG + Intronic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
997606232 5:135177443-135177465 CAGGCCCTACTGGAGGAGGAAGG - Intronic
997847749 5:137303678-137303700 CAGGCAAGGCTTCAGGAGGAGGG + Intronic
998131942 5:139655752-139655774 CCGGCACAGCTGGTGGGGGAGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
999416655 5:151403512-151403534 AAGACAAAGCTGGAGCAGGCAGG - Intergenic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1002065678 5:176650556-176650578 CAGGCCAAGTGGGAGGAGGCAGG + Intronic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002294592 5:178223319-178223341 CAGGCAAATCTGCAGGAGGCAGG - Intronic
1002307443 5:178292181-178292203 CAGGAACAGATCGAGGAGGAGGG - Intronic
1002929845 6:1625459-1625481 TGGGGAAAGCGGGAGGAGGAAGG - Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1005419115 6:25630955-25630977 GAGGAAATGCTGGAGGAGGCTGG - Intergenic
1005495213 6:26382361-26382383 CAGGCATGGCTGGAGTGGGAGGG - Intergenic
1005499919 6:26420963-26420985 CAGGCATGGCTGGAGCGGGAGGG - Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005900173 6:30210487-30210509 TATGCAAAGCTGCAGGAGGAGGG - Intronic
1006169595 6:32085438-32085460 CAAGGAAAGCTGCAGGTGGAGGG + Intronic
1006418622 6:33919797-33919819 CAGGCCAGGCTGGAGGCAGAGGG + Intergenic
1006646063 6:35515055-35515077 CAGGCAAGGCTGCCTGAGGAAGG + Intergenic
1006957627 6:37889182-37889204 CATCCAAAGCTAGAGGAAGACGG + Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007398042 6:41588247-41588269 CAGGCAGGGCGGGAGGTGGACGG + Intronic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008583434 6:52927185-52927207 TAGGCAAGGTTGGGGGAGGAGGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1009835476 6:68995774-68995796 CAGGCAGAGATGGGAGAGGAAGG - Intronic
1010116261 6:72316355-72316377 GAGGCAAGGCTGGAGGAGCAGGG - Intronic
1012329489 6:97966689-97966711 TAGGCAAAGATGGAGGAGAAAGG + Intergenic
1012482178 6:99679484-99679506 CAGACAAAGCTGTGGGAAGAAGG - Intergenic
1012556643 6:100521687-100521709 CAGGCCAAACTGGAGGATGTGGG + Intronic
1012981971 6:105840669-105840691 CAGGAAGAGCTGTAGAAGGAGGG - Intergenic
1013021347 6:106223339-106223361 CCAATAAAGCTGGAGGAGGAAGG + Intronic
1013284959 6:108673298-108673320 CAGGCCAAGCTGTAAGAAGAGGG + Intronic
1013374054 6:109496999-109497021 AAGGCGAGGCTGGAGGTGGAGGG - Intronic
1013618629 6:111868083-111868105 CAGAGAAGGCTGGAAGAGGAGGG - Intronic
1013632986 6:112002807-112002829 CAGTGAAAGCTGGAGGAGTCAGG - Intergenic
1015091570 6:129364911-129364933 CAGGCAGAGCAGGAGGAAGTGGG + Intronic
1015462323 6:133505591-133505613 CAGGAAGAGCTGGCAGAGGATGG - Intronic
1015639302 6:135313754-135313776 CAGGCACATCAGGAAGAGGAAGG + Intronic
1016026822 6:139296037-139296059 CAGCCCAGGCTGGAGGAGGGGGG - Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1017491587 6:154950325-154950347 CAGTCCTAGCTGGAGGAGAAGGG - Intronic
1017722416 6:157253194-157253216 CTGGCATAGGTGCAGGAGGATGG - Intergenic
1018076237 6:160216081-160216103 CAGGCGAAAGTGGAGCAGGAGGG + Intronic
1018124023 6:160664664-160664686 CAGGCAGTGCTGTACGAGGAGGG + Intergenic
1018368699 6:163148697-163148719 CACGCAAAGTTGGAGGCAGATGG - Intronic
1018403964 6:163457367-163457389 AAGTCACAACTGGAGGAGGAAGG - Intronic
1018648360 6:165969292-165969314 CTGCCAAAGATAGAGGAGGAGGG + Intronic
1019208035 6:170378955-170378977 CAGGCAAATCAGGAGGAGCAAGG + Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019568058 7:1694432-1694454 CACAAAGAGCTGGAGGAGGATGG + Intronic
1019825308 7:3279523-3279545 GAGGGAAAGATGGGGGAGGAGGG + Intergenic
1021776360 7:24058907-24058929 CAGGCATAGCATGAGGAAGATGG + Intergenic
1022089926 7:27101494-27101516 CACGCACAGTTGGAGGTGGAGGG + Intronic
1022924272 7:35044309-35044331 GAGGCAAGGCTGGAGAAGAAGGG - Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023953287 7:44865103-44865125 CAGGCAAAGTAGGACCAGGAAGG + Intergenic
1024213711 7:47228755-47228777 GAGGCGAGGCTGGAGGAGAAGGG - Intergenic
1024213783 7:47228963-47228985 AAGGCAGGACTGGAGGAGGATGG - Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024310224 7:47962311-47962333 AAGGAAGGGCTGGAGGAGGATGG + Intronic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1024661482 7:51499643-51499665 CAGGCCATTCTGGAGGAGTATGG - Intergenic
1024965332 7:55018970-55018992 GAGGCAGGGCGGGAGGAGGAGGG - Intergenic
1026224957 7:68432089-68432111 CAGGCAAAGATGGAGGCACAAGG - Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1027000680 7:74651804-74651826 AAGGCAGAGCTGGAGCTGGAAGG + Intergenic
1027879923 7:83821720-83821742 CAGGCAAAGATGGAGTGGGAAGG + Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1028858551 7:95620680-95620702 CAGGCAAAGATGCACTAGGAAGG - Intergenic
1028996581 7:97106980-97107002 CAGGCAGAGCTGTGGGAGCATGG - Intergenic
1029371610 7:100154339-100154361 CAGAAAAAGCTGGAGGGGAAGGG + Intronic
1029595955 7:101537795-101537817 GAGGCTAGGGTGGAGGAGGAGGG - Intronic
1029746975 7:102521405-102521427 AAGGCATTGCTGGAGGAAGAAGG + Intergenic
1029764928 7:102620494-102620516 AAGGCATTGCTGGAGGAAGAAGG + Intronic
1029822579 7:103160075-103160097 GAGGCAAGGCTGGAGAAGAAGGG - Intergenic
1029859179 7:103551098-103551120 CATGCAGGGCTGGAGGAGGGAGG - Exonic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032738160 7:134711865-134711887 CAGGCAAGGTTGGTGGAGGAGGG + Intergenic
1033224961 7:139554215-139554237 CAGCCACAGCTGGAGCAGGCGGG - Intergenic
1033596775 7:142864596-142864618 CATGCAGAGCCAGAGGAGGATGG + Exonic
1033665147 7:143433980-143434002 CAGGGAAAGGTGGAGGAAAAAGG - Intergenic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035285907 7:157807130-157807152 CTGGCAAAGCTGTAGGTGAACGG + Intronic
1035586864 8:782951-782973 CCGGGAAAGCTGGATTAGGATGG + Intergenic
1035592209 8:824677-824699 CAGACAAAGCTTGCAGAGGATGG - Intergenic
1035737702 8:1900835-1900857 GAGGCAAGGAGGGAGGAGGACGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1037260395 8:17001662-17001684 CAGGCAAAGAGGGAGGTGCAAGG + Intronic
1037269312 8:17108703-17108725 GAGGCAAAGCTGGAAGCAGAAGG - Intronic
1037365904 8:18122067-18122089 CAGCCAAAGCAGGAGAGGGATGG - Intergenic
1037636105 8:20702103-20702125 CTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1037881379 8:22575039-22575061 GAGGAAACGCTGGAGCAGGATGG - Exonic
1038622770 8:29159693-29159715 GCGGCAAAGCTGGGGTAGGAGGG - Intronic
1039407034 8:37322132-37322154 CAAGCAAAGAGGGAGGAGGTGGG - Intergenic
1039407932 8:37328681-37328703 CAAGCAGAGTTGGGGGAGGAGGG - Intergenic
1041942314 8:63402300-63402322 CAAGCAAAGCTGGAAGTGGGAGG + Intergenic
1043401096 8:79885071-79885093 CAGGCTAAGTGGGAGGGGGAAGG + Intergenic
1043769772 8:84183699-84183721 TTGGGAAAGCTGGAGGAGCATGG + Intronic
1044376064 8:91472586-91472608 GAGGCAGAGGTGGAGAAGGAAGG + Intergenic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045360992 8:101433094-101433116 AAGGCAAAGTTGGAGGGAGACGG - Intergenic
1045560499 8:103257429-103257451 CAGGTAAGCATGGAGGAGGAGGG - Intergenic
1045703291 8:104891986-104892008 CAGACACAGCTGCAGGAGGTGGG + Intronic
1046839486 8:118841274-118841296 CAGGCAAAGCTGGAGGGGCTGGG - Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048271679 8:133033346-133033368 GAGGCCAGGCTGGAGGATGAAGG + Intronic
1048378137 8:133840425-133840447 GAGTCAAATCTGAAGGAGGAAGG - Intergenic
1048582950 8:135745506-135745528 CAGGGAAAGATGGAGGATTAGGG + Intergenic
1049084871 8:140470799-140470821 ATGGCAAAGCTGGAGCAGGGTGG - Intergenic
1049205200 8:141360462-141360484 CAGACGAAGCTGGGAGAGGAGGG - Intronic
1049241722 8:141540751-141540773 TCCGCAAACCTGGAGGAGGAGGG - Intergenic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1049791325 8:144473994-144474016 GCGGCAAAGCTGCAGGAGCAGGG - Exonic
1049999021 9:1056645-1056667 CAGGCATTGCTGGTAGAGGAGGG - Exonic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053158167 9:35794113-35794135 GAGCCAAATCTGAAGGAGGAGGG + Intronic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055555488 9:77469247-77469269 CAAGGAAAGCTGGGAGAGGAGGG + Intronic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057354001 9:94320596-94320618 GAGGCAGAGAGGGAGGAGGATGG + Intronic
1057653764 9:96937039-96937061 GAGGCAGAGAGGGAGGAGGATGG - Intronic
1057704609 9:97388070-97388092 CAGGCACTGCTGGAGAAGCAAGG + Intergenic
1058876730 9:109251151-109251173 CAGGCAGTGCTGGGAGAGGAAGG - Intronic
1059043942 9:110843873-110843895 TCGACACAGCTGGAGGAGGAGGG - Intergenic
1059427734 9:114231590-114231612 CAGGCAAATCCAGAGGAAGAAGG - Intronic
1059847889 9:118301873-118301895 CAGACAAAGATGGAGAAGGCAGG - Intergenic
1060010724 9:120040868-120040890 GAGGCAAAGCTGGAGGCAGCCGG - Intergenic
1060310243 9:122453104-122453126 AAGGCAAAGCTGGAGCAGGCAGG - Intergenic
1060485651 9:124044913-124044935 CAGGCAAAGATGGATGTGGGTGG + Intergenic
1060488865 9:124067139-124067161 CATGCATAGCTGGAGGTGGTGGG + Intergenic
1060624703 9:125101105-125101127 CAGGCACAGATTGATGAGGAGGG + Intronic
1060970724 9:127736121-127736143 CAGGCCAAGCTGGAGGCCTAGGG - Intergenic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061865707 9:133490901-133490923 GAGGAAAAGGTGGAGGAGGGAGG + Intergenic
1061865750 9:133491050-133491072 GAGGAAAAGCTGGAGGATGAGGG + Intergenic
1061915889 9:133753708-133753730 TAGGCAAAGTTGGGGGAGGAGGG - Intergenic
1062264504 9:135680757-135680779 TAGGCAAGGTTGGGGGAGGAGGG + Intergenic
1062365100 9:136204668-136204690 CAGGCACAGCTGGGGGGCGATGG - Intronic
1062376357 9:136263617-136263639 CAGGCCAAGCTGCAGCAGGTGGG - Intergenic
1062697951 9:137884963-137884985 CAGGCAAAGTGGGAGGAGGGGGG - Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1185430849 X:10974-10996 CAGGCAGAGCTGGGGCTGGATGG - Intergenic
1185440115 X:223371-223393 CAGGCAGAGCTGGGGCTGGATGG - Intergenic
1186114104 X:6287199-6287221 ATGGCAATGCTGGAGGGGGAGGG - Intergenic
1186360418 X:8835747-8835769 CAGGCGAACATGGGGGAGGATGG - Intergenic
1186992417 X:15084428-15084450 CAGCCAAAGCTGGAGCAGCTGGG - Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187270683 X:17776658-17776680 CAGGCAGAGGTGGTAGAGGAGGG - Intergenic
1187319823 X:18229067-18229089 CAGGCAGAGGTGGCAGAGGAGGG + Intergenic
1189231092 X:39453017-39453039 CAGACAAAGCTGGAGGCACAAGG + Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189592576 X:42530686-42530708 CAGGCAAAGTGAGAAGAGGAAGG - Intergenic
1189787380 X:44571580-44571602 AAGGCAGAGCTGGGGGAAGAGGG + Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1192190920 X:68990765-68990787 CAGGCAGGGCTGCTGGAGGAGGG - Intergenic
1192552985 X:72068808-72068830 AAGGCAAAGCAGGAGAGGGAGGG + Intergenic
1195418548 X:104647203-104647225 CTGGGACAGCTGGAGGAGGCAGG + Intronic
1195945595 X:110207327-110207349 AAGGCTAAGCTGGAGTAGTAGGG - Intronic
1196911854 X:120491874-120491896 CAGGCAAGGGTTAAGGAGGAAGG + Intergenic
1197612345 X:128653516-128653538 CAAGGAAAGCTGGGAGAGGAAGG + Intergenic
1197753369 X:129980308-129980330 CGGGCGAAGCGGGAGGAGGGAGG - Intergenic
1198216707 X:134562044-134562066 CAGGTGAAGATGTAGGAGGAGGG - Intergenic
1199088240 X:143657831-143657853 TAGGCGTAGCTGCAGGAGGATGG + Intergenic
1200791445 Y:7303254-7303276 AAGGCAGAGATGGAGGAGGAGGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic