ID: 1009405229

View in Genome Browser
Species Human (GRCh38)
Location 6:63304259-63304281
Sequence ATGCCCATCTAGAAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009405229_1009405231 3 Left 1009405229 6:63304259-63304281 CCTTCACCTTTCTAGATGGGCAT 0: 1
1: 0
2: 5
3: 46
4: 224
Right 1009405231 6:63304285-63304307 TTGTTAGTTCCCTTTTTCTATGG 0: 1
1: 0
2: 5
3: 30
4: 323
1009405229_1009405232 8 Left 1009405229 6:63304259-63304281 CCTTCACCTTTCTAGATGGGCAT 0: 1
1: 0
2: 5
3: 46
4: 224
Right 1009405232 6:63304290-63304312 AGTTCCCTTTTTCTATGGCTTGG 0: 1
1: 0
2: 1
3: 24
4: 233
1009405229_1009405235 19 Left 1009405229 6:63304259-63304281 CCTTCACCTTTCTAGATGGGCAT 0: 1
1: 0
2: 5
3: 46
4: 224
Right 1009405235 6:63304301-63304323 TCTATGGCTTGGAGTAAATGAGG 0: 1
1: 3
2: 8
3: 33
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009405229 Original CRISPR ATGCCCATCTAGAAAGGTGA AGG (reversed) Intronic
900554335 1:3272284-3272306 AGGCCCATCTAGAGAGGTAGGGG + Intronic
901481044 1:9525458-9525480 ATGCCCACCCACATAGGTGAGGG + Intergenic
902188826 1:14746131-14746153 ATGCCCATCACGAAAGCTGTGGG - Intronic
903630065 1:24761739-24761761 ATTGCCATCAAGAAAGGTGATGG + Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906598893 1:47106226-47106248 GCGTCCATCTGGAAAGGTGATGG - Exonic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907941852 1:59095842-59095864 ATGCCCATCTAGGCTGGGGAGGG - Intergenic
908488106 1:64615205-64615227 ATTCTTATCTAGAAGGGTGAGGG - Intronic
908529483 1:65020792-65020814 AGGACCATCTACAAAGGTGTGGG + Intergenic
908559216 1:65288171-65288193 ATGGCAATGTAGACAGGTGAAGG - Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
910980769 1:92958836-92958858 ATGCATATCTAGAAAGGGGTGGG + Intronic
912523024 1:110259425-110259447 ATGTCCATTTAGTAAGATGAAGG - Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917099532 1:171431447-171431469 ATGGGCAGCTAGAAAGGGGATGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918520329 1:185407814-185407836 ATGCCCATTTAGAGATGGGACGG - Intergenic
918642725 1:186862821-186862843 GAGCTCCTCTAGAAAGGTGAAGG + Intronic
921258533 1:213364616-213364638 GTGCCCAGCTAGAAAAGAGAGGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
924418586 1:243885626-243885648 ATGCCCACCTGCACAGGTGAGGG - Intergenic
924478094 1:244399100-244399122 ATGCCCATCCACATTGGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063906175 10:10782455-10782477 ATGCCCATCTACATTGGGGAGGG + Intergenic
1064052587 10:12071009-12071031 ATTTCCACCTAGAAAGCTGATGG - Intronic
1064151247 10:12866943-12866965 ATGCCCATCTATATAGAAGATGG + Intergenic
1065326494 10:24554399-24554421 GTGTCAATCTAGAAAGGTGGAGG + Intergenic
1065924170 10:30421243-30421265 CTGCCCCTCAAGACAGGTGACGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067036003 10:42917576-42917598 ATGCCCATCCACATTGGTGAGGG + Intergenic
1067302124 10:45021587-45021609 ATGCTCATCTACATTGGTGAGGG - Intergenic
1073686593 10:105761095-105761117 GTTCCCATCAGGAAAGGTGATGG - Intergenic
1074880893 10:117657357-117657379 ATGATCATCAAGAAAGGAGAGGG - Intergenic
1076449424 10:130546249-130546271 ATGCCCATAGAGAATGGTAAAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079912924 11:26332926-26332948 ATGCCCAGCAAGAAACTTGAGGG - Intronic
1080907716 11:36563266-36563288 ATGCCCATCCACATTGGTGAGGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083231313 11:61322211-61322233 ATGCTTATCTAGAATGGGGAGGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091556665 12:1578913-1578935 GAGCACCTCTAGAAAGGTGAAGG - Intronic
1092781837 12:11994800-11994822 TTGCCCTTGGAGAAAGGTGAAGG - Intergenic
1094024232 12:25945510-25945532 GTGCCCATCTGGAAGGATGAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098322662 12:69262062-69262084 ATGCACAAATAGAAAGGTAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099091505 12:78316187-78316209 ATGCCCTTCTAGGAAGGGAAGGG + Intergenic
1099774501 12:87107536-87107558 ATGCCTATCCACAATGGTGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100906110 12:99301200-99301222 ATGCCCATCCACACTGGTGAGGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102616145 12:114156065-114156087 ATGCCCATCTCCAAGGGGGATGG + Intergenic
1105429133 13:20321191-20321213 ATGCACATCTAGGAAGGAGAGGG + Intergenic
1106033349 13:26022180-26022202 TTGCACACCCAGAAAGGTGATGG + Exonic
1106823730 13:33494539-33494561 AAGCCCATGCAGAAAGGTGGGGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114919707 14:27311393-27311415 ATGCCCTTCTAGAATGCTGCAGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116121011 14:40722515-40722537 ATGACCATTTAGAAATGTCATGG + Intergenic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116556648 14:46319289-46319311 ATGCTCATCCACATAGGTGAAGG - Intergenic
1119891685 14:78187433-78187455 ATCCCCAACTACAAAGATGATGG - Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG + Intergenic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1126265845 15:46753060-46753082 ATGCCCATCCACAGTGGTGAGGG + Intergenic
1126927266 15:53603764-53603786 ACAGCCAACTAGAAAGGTGAAGG + Intronic
1128189891 15:65682196-65682218 ATGCCCATCTAGGACTTTGATGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128667942 15:69552407-69552429 TTCCCCATCAAGAAAGGTGGGGG - Intergenic
1130241888 15:82201343-82201365 GTGCTCATCTACAAAGGAGAGGG + Intronic
1130458491 15:84139510-84139532 GTGCTCATCTACAAAGGAGAGGG - Intergenic
1130741335 15:86603531-86603553 ATGCCCATCTAGAAAGTAAAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1132629822 16:911763-911785 ATGCCCATCTGGGAAGGACAGGG - Intronic
1132731332 16:1363699-1363721 ATGGCCACCAAGACAGGTGAGGG + Exonic
1135849915 16:25953854-25953876 TTGTCCACCTTGAAAGGTGAGGG + Intronic
1135972143 16:27080165-27080187 AGGCCCAACCAGAAATGTGATGG - Intergenic
1136638917 16:31545542-31545564 ATGCCCATCGACAAGCGTGAAGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1138929866 16:61639836-61639858 ATGGCCATATTGAAAGATGAAGG - Intergenic
1140931964 16:79636011-79636033 ATGCCCATCTACAGAGGAGCTGG - Intergenic
1143040752 17:4034533-4034555 ATGGACATTTTGAAAGGTGAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146363909 17:32203551-32203573 ATACCCATCTAGAAATATGTCGG - Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1152029313 17:77831838-77831860 ATGCCCATCTACCTTGGTGAGGG - Intergenic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155047362 18:22114520-22114542 CTGCCCAGCAAGGAAGGTGAAGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157907851 18:51585616-51585638 ATACCCATAGAGAAAGGTGGTGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164452532 19:28379259-28379281 AAGCCCAGCTACAAAAGTGAGGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1167740472 19:51322197-51322219 ATCCCCACCCAGGAAGGTGAAGG - Intronic
1168152379 19:54456027-54456049 CTGCCCCTCTAGGAGGGTGAAGG - Exonic
1168593362 19:57654584-57654606 CTGGCCATCTGGAAAGCTGATGG + Intergenic
925096517 2:1208555-1208577 AAGCCCGTCTGGGAAGGTGAAGG - Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926687138 2:15706788-15706810 ATGCCCATCCACATTGGTGAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
931041637 2:58307126-58307148 ATGCCCATCCAGAAAAATAAAGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
938170955 2:129076291-129076313 ATGCCTAGCTGGAAAGGGGAAGG - Intergenic
939010102 2:136836561-136836583 ATGGGGATCTAGAAAGGTGATGG - Intronic
939722157 2:145667378-145667400 ATGCCCTTTGAAAAAGGTGATGG - Intergenic
942478663 2:176357982-176358004 ATGCCCACCTACACGGGTGAGGG - Intergenic
942694923 2:178630936-178630958 TTCCCGATCTAGAAAAGTGAAGG + Exonic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943400293 2:187400831-187400853 AGGCAAATCTATAAAGGTGAAGG + Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
947759303 2:232591965-232591987 ATGCCCACCTACACTGGTGAGGG - Intergenic
949074065 2:242044163-242044185 ATGAACATCTGGAAAGGAGAAGG + Intergenic
1169381825 20:5113740-5113762 ATTTCCATCTAGATTGGTGATGG - Intergenic
1170199922 20:13731751-13731773 ATGCACAATTAGAAAGGTGAGGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171231029 20:23485288-23485310 ATGCCCATCCACACTGGTGAGGG + Intergenic
1175602837 20:60288895-60288917 ATGATCATCTCGGAAGGTGAAGG + Intergenic
1177193956 21:17882527-17882549 AATCCCATTCAGAAAGGTGAGGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1178099966 21:29257335-29257357 ATACCCAGCAAGAAAGGAGATGG - Intronic
1178633348 21:34281367-34281389 ATGCCCATCGACAAGGGAGATGG + Intergenic
1179177328 21:39018309-39018331 ATTCACATCCAGAAAGCTGAGGG - Intergenic
1181118293 22:20647946-20647968 ATGGTCATCTAGCAAGGGGAGGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182959936 22:34462724-34462746 ATGTCCAACTAGCAGGGTGAAGG - Intergenic
949752219 3:7367152-7367174 ATTCCCATCTAGAAAGAATATGG - Intronic
950270508 3:11611044-11611066 TTGCACACCTAGAAAGATGATGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951688860 3:25374459-25374481 ATGCCTAGCTTGAAGGGTGAAGG + Intronic
956097901 3:65736738-65736760 ATGCCCATCCACATTGGTGATGG + Intronic
956517637 3:70067083-70067105 AAGACCATCTAGAAGGGTCAGGG + Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
963917599 3:150873360-150873382 CTGCCCACCTGGAAAGGGGAAGG + Exonic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965158392 3:165096340-165096362 ATGCCCATGTATCAAGGTCAGGG + Intergenic
965422628 3:168480886-168480908 ATGCCCATCCACATTGGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969927561 4:10599392-10599414 TTGACCATCTAGAAAGATGATGG + Intronic
970006317 4:11414250-11414272 AGGCCCCTCTTGAAAGGAGATGG - Intronic
971590367 4:28460194-28460216 ATGCCCACCTACATTGGTGAGGG - Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972987573 4:44783294-44783316 ATGCCCATCTACATTGGTGAGGG - Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
974942360 4:68484657-68484679 ATGGCTAACTAGGAAGGTGAAGG - Intronic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
978052578 4:104220557-104220579 ATGCCCATCCACATTGGTGAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979346687 4:119595493-119595515 ATGCCCACCTACATTGGTGAGGG - Intronic
980896012 4:138861054-138861076 TTGCCCATCTGTAAAAGTGAGGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981155213 4:141427060-141427082 ATGCCCATCTGCACTGGTGAGGG - Intergenic
981634742 4:146863908-146863930 ATGCCCATCCACATAGGGGAAGG + Intronic
982402980 4:154988853-154988875 ATGCCCAACTACAATGGGGAGGG + Intergenic
982476021 4:155851763-155851785 ATGCATATCTGGAAAAGTGATGG - Intronic
987691237 5:21269673-21269695 TTGGCTATATAGAAAGGTGAGGG - Intergenic
988103951 5:26718911-26718933 ATGCCCATCTACATAAGTGAGGG - Intergenic
988294692 5:29341018-29341040 ATGGCCTTCAAGAAAGATGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990109948 5:52310296-52310318 TTCCCCATCTATAAAGGTGGAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991450362 5:66744596-66744618 ATGACCATGATGAAAGGTGAAGG + Intronic
992843939 5:80725890-80725912 ATGACCAGCTAGTAAGTTGATGG + Intronic
993242779 5:85412462-85412484 CTGCCCATTTAGTATGGTGATGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996948291 5:129095253-129095275 ATGCCCCTGTCCAAAGGTGATGG + Intronic
1004509468 6:16273600-16273622 ATTCCCATCTAGACAGGAAAGGG - Intronic
1004904644 6:20226022-20226044 ATGCCCACTTACAATGGTGAGGG - Intergenic
1005706575 6:28460713-28460735 ATGCACATGTAGAAAGGTCCTGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006884752 6:37371857-37371879 CTCCACTTCTAGAAAGGTGAGGG + Intronic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012096051 6:94962752-94962774 ATGCACTTCTAGAATGGTGCAGG + Intergenic
1013793763 6:113860942-113860964 ATGCCCATATATGAAGGAGATGG + Exonic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015569614 6:134607421-134607443 ATTCCCATCTAGAAAGATACTGG - Intergenic
1015830407 6:137362907-137362929 ATGTCCACCGAGAAAGGAGAGGG - Intergenic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1017252159 6:152292169-152292191 AGGCCCCTTTAGAAAGGAGAGGG + Intronic
1017319674 6:153075325-153075347 ATGCCCAGTTACAAAAGTGAAGG - Intronic
1017386442 6:153890225-153890247 ATGCCCACCCAGAAGGGTGAAGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019632031 7:2054592-2054614 ATGTCAGTCTAGAAAGGTAATGG + Intronic
1019757849 7:2786835-2786857 ATGCCCATCTCGAGACCTGAAGG + Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020650458 7:10868797-10868819 ATGCCCATCTGTAAAAGTGAGGG - Intergenic
1022076102 7:26972709-26972731 TGGCCCATCTAGCAAGGTTAGGG + Intronic
1022862184 7:34378950-34378972 ATGCCCACCTAGAAAGTTGAAGG + Intergenic
1023244442 7:38186075-38186097 ATTACTATCTAGACAGGTGAAGG - Intronic
1026011267 7:66638416-66638438 ATGCCCTATTACAAAGGTGAGGG + Exonic
1026233563 7:68506534-68506556 ATGCCCACCTACATTGGTGAGGG - Intergenic
1026381074 7:69799881-69799903 CTGCCCAGGTAAAAAGGTGAGGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027713435 7:81638457-81638479 ATGTCAATCTAGCAAGGCGATGG + Intergenic
1029016425 7:97319690-97319712 ATTCCCACCTTGAAGGGTGAAGG + Intergenic
1029309627 7:99650610-99650632 ATGCTCATTGAGAAAGGAGAAGG + Intronic
1029477577 7:100794105-100794127 CTGCCCAGCTAGAAAGGGGAAGG - Exonic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032166315 7:129547776-129547798 ATGCCCATCCACATTGGTGACGG + Intergenic
1032401980 7:131630054-131630076 AAGCCCACCTGGCAAGGTGAGGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035485427 7:159220334-159220356 ATGCCCACCCAGAAAGAGGAAGG + Intergenic
1038928464 8:32166919-32166941 ATGTCCATTTTGAATGGTGAAGG - Intronic
1038951215 8:32416438-32416460 ATGCCCTCATAGAATGGTGAGGG - Intronic
1039448254 8:37649562-37649584 TTCCCCATCTAGAAAGATAAAGG + Intergenic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1042523915 8:69744427-69744449 ATGCCAATCCTGAAAGTTGATGG - Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1044186882 8:89263974-89263996 ATCCCCATCTAGAAAAGTACAGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1048214476 8:132481634-132481656 TTGCCCACCCAGACAGGTGAAGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056086161 9:83151413-83151435 TGGCCCATCTAGAAAGCTGGGGG - Intergenic
1056458978 9:86791163-86791185 GTGCCCAGCTAGTTAGGTGAGGG + Intergenic
1057268422 9:93633784-93633806 ATGACCATGCAGACAGGTGACGG + Intronic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1059818315 9:117943675-117943697 TACCACATCTAGAAAGGTGAAGG + Intergenic
1059979979 9:119760923-119760945 AGTCCCATCCAGTAAGGTGAAGG - Intergenic
1061290086 9:129645798-129645820 ATGCCCATTTAGAAAGGAGGGGG - Intergenic
1186316547 X:8376702-8376724 ATGACCAGCTAGGAAGATGATGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187730196 X:22244843-22244865 ATGCCCAACTTCAAAGGAGATGG + Intronic
1188644349 X:32546138-32546160 ATGCCCATGTATTGAGGTGATGG - Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189248283 X:39580386-39580408 ATGCGCACCTGGCAAGGTGAAGG - Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1191822130 X:65322258-65322280 ATGCCATTCTTGAAAGGTGGGGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1194538697 X:95142479-95142501 ATGCCCACCTACAATGGGGAAGG - Intergenic
1194860121 X:98988754-98988776 ATGCTCAGCTAAAAAGATGATGG - Intergenic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1198273947 X:135083552-135083574 ATGCCCACCTACACTGGTGAGGG - Intergenic
1199528910 X:148825122-148825144 ATGGACTTCCAGAAAGGTGAGGG + Intronic
1201421059 Y:13799487-13799509 ATGCTCATCTCTGAAGGTGAAGG - Intergenic