ID: 1009405725

View in Genome Browser
Species Human (GRCh38)
Location 6:63310087-63310109
Sequence AGTTTTGTACAGATGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009405725_1009405728 -4 Left 1009405725 6:63310087-63310109 CCTATCTCCATCTGTACAAAACT 0: 1
1: 0
2: 0
3: 20
4: 251
Right 1009405728 6:63310106-63310128 AACTAGTTTTATCATTTCTTGGG No data
1009405725_1009405730 22 Left 1009405725 6:63310087-63310109 CCTATCTCCATCTGTACAAAACT 0: 1
1: 0
2: 0
3: 20
4: 251
Right 1009405730 6:63310132-63310154 ACACTGTTTCCTTCTTTCCTAGG 0: 1
1: 0
2: 3
3: 37
4: 401
1009405725_1009405729 -3 Left 1009405725 6:63310087-63310109 CCTATCTCCATCTGTACAAAACT 0: 1
1: 0
2: 0
3: 20
4: 251
Right 1009405729 6:63310107-63310129 ACTAGTTTTATCATTTCTTGGGG 0: 1
1: 0
2: 4
3: 34
4: 435
1009405725_1009405727 -5 Left 1009405725 6:63310087-63310109 CCTATCTCCATCTGTACAAAACT 0: 1
1: 0
2: 0
3: 20
4: 251
Right 1009405727 6:63310105-63310127 AAACTAGTTTTATCATTTCTTGG 0: 1
1: 0
2: 2
3: 41
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009405725 Original CRISPR AGTTTTGTACAGATGGAGAT AGG (reversed) Intronic
902112807 1:14097112-14097134 AGTTTTGTAAAGGTGGAAGTTGG + Intergenic
903204872 1:21773964-21773986 AGTTTTTTAAAAATAGAGATGGG - Intronic
903561984 1:24235047-24235069 TGTTTGTTACAGCTGGAGATGGG + Intergenic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
903893780 1:26588748-26588770 ATTTTAGTACAGATGGGGTTTGG + Intergenic
904032785 1:27543545-27543567 AGGTTTGCACACATGGAGACCGG - Intronic
904766462 1:32852508-32852530 AGTTTAGAACAGATGGAGGTGGG - Intronic
905102542 1:35537843-35537865 ATTTCTGTACAGATACAGATTGG - Intronic
907501504 1:54884929-54884951 AGGGATGGACAGATGGAGATGGG + Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
908538347 1:65099668-65099690 TGTTTTGTAGAGATGGGGTTTGG - Intergenic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
912406438 1:109442350-109442372 AGTCAGGGACAGATGGAGATGGG + Intergenic
915924607 1:160006267-160006289 ATTTTTGTAGAGATGGAGTCTGG + Intergenic
916317978 1:163471588-163471610 TTTTTTTTTCAGATGGAGATAGG - Intergenic
916600076 1:166284047-166284069 AGTTTGGAAAAGGTGGAGATTGG + Intergenic
917369115 1:174269425-174269447 AGTTTTGTAGTGATAGACATGGG + Intronic
919346975 1:196394460-196394482 AGTTCTATACAGATGGTGCTGGG + Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
921666335 1:217876509-217876531 AGTTCAGTGAAGATGGAGATAGG + Intergenic
922390906 1:225140016-225140038 AGATTTTTCCAGATCGAGATAGG - Intronic
923137521 1:231131415-231131437 AGATTTCAACAGATAGAGATGGG - Intergenic
923225985 1:231939416-231939438 AGTTCATTACAGATGGAGAAAGG - Intronic
1062966549 10:1611805-1611827 AGTTTCCTTCAGAAGGAGATGGG - Intronic
1064582467 10:16808304-16808326 ATTTTAGTAGAGATGGGGATGGG - Intronic
1065014324 10:21447841-21447863 AGTTCTGTTAATATGGAGATGGG - Intergenic
1065094208 10:22264551-22264573 ATTTTTGTAGAGATGGTGGTCGG - Intergenic
1065268531 10:24002436-24002458 ATTTTTGTAAAGAAGGAGAGAGG - Intronic
1067403478 10:45999318-45999340 TTTTTTGTACAGATGGGTATCGG + Intronic
1067544149 10:47179842-47179864 AATTTTGTAGAGATGGGGGTGGG - Intergenic
1071977325 10:90968008-90968030 AGTTCTGTTCAGATGGGAATAGG - Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074851194 10:117440859-117440881 TGTTTTCTAGAGATGGAGGTGGG + Intergenic
1074959693 10:118431162-118431184 ATTTTTTTCCATATGGAGATTGG + Intergenic
1076025001 10:127104430-127104452 AGTTTTGTACAGTGTGAGAGAGG + Intronic
1076323020 10:129597793-129597815 ACTTCTGTAGAGAAGGAGATAGG - Intronic
1078302664 11:10148682-10148704 TGTTTTGTACAGAGGGAGACAGG - Intronic
1079520708 11:21323093-21323115 TGTTTTGTACAGACGAATATGGG - Intronic
1080621134 11:33988070-33988092 AGTTTTGCAGAGAAGGAGGTAGG - Intergenic
1088035953 11:105316010-105316032 GGTTTTGTTCAGATGGAGTCTGG + Intergenic
1088078954 11:105886128-105886150 AGTTTTGTATACATGGCTATTGG - Intronic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1092054721 12:5499386-5499408 TGTTTGGTTCAGATGGAGATTGG + Intronic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1092377498 12:7967975-7967997 AGTTTTTTAAAGATAGAGATTGG + Intergenic
1093200621 12:16182123-16182145 GGTTTTGTTCATATGGAAATGGG - Intergenic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1093971489 12:25380115-25380137 AGTGGTGAAAAGATGGAGATAGG - Intergenic
1096326276 12:50665024-50665046 TTTTTTGTAGAGTTGGAGATGGG + Intronic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1098542472 12:71672076-71672098 TGTTTTGTACAAATGCAGTTGGG - Intronic
1099715978 12:86294591-86294613 AATTTTGTACAGTTGCAGAAAGG - Intronic
1100372082 12:93977756-93977778 ACATTTAGACAGATGGAGATGGG + Intergenic
1102260642 12:111441202-111441224 TTTTTTGTAGAGATAGAGATAGG - Intronic
1104351035 12:128044179-128044201 AGTTTTCTCCAGCTGGAGAAAGG + Intergenic
1104356764 12:128093731-128093753 GCTTTTGTACAGATGGAAAAGGG + Intergenic
1104422045 12:128644260-128644282 ACATTTGTCCACATGGAGATAGG + Intronic
1105541894 13:21322959-21322981 AGCTTTGTGCAGATGGACTTGGG + Intergenic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1106967388 13:35087928-35087950 AGTTTTCTATAGCTGGAGTTTGG + Intronic
1108081558 13:46742335-46742357 AGTTTTGTATAGATCAAGTTGGG - Exonic
1108559021 13:51625010-51625032 AGTTTTGAGCAGATCAAGATTGG + Intronic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1113475601 13:110578585-110578607 AGTTTGGAGCACATGGAGATGGG + Intergenic
1116041908 14:39696311-39696333 TGACTTGTACAGATGGATATAGG + Intergenic
1116127310 14:40804269-40804291 TGTTTTGTAAAGAAAGAGATTGG + Intergenic
1117283908 14:54267448-54267470 AGTTTTGTGCACATGGAGGTTGG - Intergenic
1120301930 14:82718966-82718988 AGTTTTGTACTACTGGAGAAGGG + Intergenic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1125708591 15:41764713-41764735 TTTCTTGTAGAGATGGAGATGGG + Intronic
1127413699 15:58735117-58735139 AGCTGTGTTCAGATAGAGATGGG - Intronic
1129012365 15:72432478-72432500 ATTTTTGTAGAGATGGGGTTTGG + Intergenic
1130003641 15:80070629-80070651 GGTTATGTATAGATGGAGAGTGG + Intronic
1131524385 15:93141128-93141150 AGTTTTGTACATAAGAAGAGTGG - Intergenic
1131706232 15:94999365-94999387 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1133842976 16:9427284-9427306 TGTTTTTTCCAAATGGAGATGGG - Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1139021499 16:62755604-62755626 ATTTCTTTAGAGATGGAGATTGG + Intergenic
1140264221 16:73406638-73406660 AGTATTTTACAGATGCATATGGG - Intergenic
1142236810 16:88926308-88926330 AGGTTTGTCCAGCTGGACATTGG - Intronic
1142636278 17:1259763-1259785 ATTTTTGTAGAGATGGGGGTGGG - Intergenic
1143827480 17:9622375-9622397 AGTTTTGTAAAGATGAGGAAGGG - Intronic
1143945153 17:10584884-10584906 AGGGCTGTACAGGTGGAGATGGG + Intergenic
1144073540 17:11696134-11696156 ATTTTTGTAAAGATAGACATAGG - Intronic
1148980058 17:51565659-51565681 AGTGAGGGACAGATGGAGATGGG - Intergenic
1150183466 17:63153495-63153517 AGATTTGTCCAAATGCAGATTGG + Intronic
1150460593 17:65347018-65347040 TGTTTTGTAGAGATGGAGAATGG + Intergenic
1150666332 17:67142327-67142349 TTTTTTGTAGAGATGGAGTTTGG - Intronic
1152115511 17:78384538-78384560 GGTTTTGTACAGATTTGGATGGG + Intronic
1152490159 17:80625886-80625908 AGATTTGCACAGCTGGAGACGGG - Intronic
1155758942 18:29540279-29540301 TGTTTTGTACAAATGCAGTTTGG + Intergenic
1155971012 18:32083732-32083754 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1156109506 18:33708048-33708070 AGTTTTGATCAAGTGGAGATTGG + Intronic
1156825804 18:41429119-41429141 AGTTTTGTACAGCTGAAGCTGGG + Intergenic
1157847428 18:51017137-51017159 AGATTTGTAAAGATGGAGGCAGG + Intronic
1157932329 18:51836677-51836699 AGATGTGTAAAGATGGAGTTAGG - Intergenic
1158023846 18:52872418-52872440 AGATTTGCACTGATGGAGCTGGG - Intronic
1158622269 18:59043213-59043235 AGTTTTGTACGACTGGAGAAGGG + Intergenic
1158863153 18:61612822-61612844 AGGTCTGTACAGATGGGCATGGG - Intergenic
1158959589 18:62578604-62578626 AATTTTGTAAAAGTGGAGATAGG + Intronic
1159405716 18:68000530-68000552 AGTTTTCAAGACATGGAGATGGG + Intergenic
1159733441 18:72062080-72062102 ACTTTAGAGCAGATGGAGATAGG - Intergenic
1161143130 19:2660611-2660633 TTTTTTGTACAGATGGTGGTGGG - Intronic
1161237924 19:3207118-3207140 GGGTTTGTAGAGATGGAGACTGG - Intronic
1166070812 19:40386529-40386551 CTTTTTGTAGAGATAGAGATGGG + Intronic
1166797577 19:45436646-45436668 AGTTTTGTAGAGATGAAGCGGGG + Intronic
1167464655 19:49644338-49644360 GGCTTTGTGCAGATGGCGATAGG + Intronic
1168260304 19:55189814-55189836 TTTTTTGTAGAGATGGAGGTCGG - Intronic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926514544 2:13825423-13825445 ATTTTTGTACAGATGGATTTGGG - Intergenic
926650572 2:15339675-15339697 AGTTTTATACATATTGATATGGG + Intronic
927518715 2:23686776-23686798 AGGTTTGTAGAGATGGGGCTGGG + Intronic
931829286 2:66034321-66034343 TTTTTAGTAGAGATGGAGATGGG + Intergenic
932398589 2:71464704-71464726 AGTTTTGCACTGAGTGAGATGGG + Intronic
935427827 2:102939626-102939648 AGTTTTGTTCAGATAAAGCTTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937961285 2:127461607-127461629 TTTTTTGTAGAGATGGAGACGGG - Intronic
938027533 2:127963405-127963427 TCTTTTGTAGAGATGGAGTTTGG + Intronic
939179097 2:138783214-138783236 TGTTTAGTACAGCTGGAGAAAGG + Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940948394 2:159644863-159644885 AGTTTTCAGAAGATGGAGATTGG - Intergenic
941266545 2:163370068-163370090 AGATTTGTAGAGCTTGAGATTGG - Intergenic
941612925 2:167683541-167683563 TTTTTTGTAGAGATGGAGTTTGG - Intergenic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
945906050 2:215594464-215594486 TTTTTTGTAGAGATGGAGTTTGG - Intergenic
946383463 2:219365751-219365773 ATTTTTGTATAGATGGGGTTTGG + Intergenic
947211223 2:227710382-227710404 ATTTTTGTAGAGATGGAGTCTGG - Intronic
1169504034 20:6189229-6189251 CATTTTCTACATATGGAGATAGG - Intergenic
1171528357 20:25834019-25834041 AGTTTTGCAAAGATGGAGCCTGG + Intronic
1171548469 20:26021859-26021881 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG + Intergenic
1173474691 20:43350686-43350708 TTTTTAGTAGAGATGGAGATGGG - Intergenic
1173636385 20:44562431-44562453 ATTTTTGTAGAGATGGCGTTTGG - Intronic
1174660047 20:52204492-52204514 ACTTTTGCACATATAGAGATCGG + Intergenic
1175866250 20:62178721-62178743 ATTTTTGTAGAGATGGAGTCTGG + Intronic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1182187102 22:28416468-28416490 AGTTCTTTAGGGATGGAGATGGG - Intronic
1184050096 22:41997955-41997977 AGTTGTGTCCAGGTGGAGACAGG - Exonic
949800610 3:7899831-7899853 AGTTCTGTAAAGAATGAGATTGG - Intergenic
949855660 3:8458777-8458799 AGTTTTGTTCAGATGGGAAGGGG + Intergenic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
955248856 3:57257068-57257090 AGTTATTTAAAGAAGGAGATGGG + Intronic
957457844 3:80475147-80475169 AGTTTTGTAAACATGTAAATAGG - Intergenic
957550575 3:81698424-81698446 ATTTTTGTCCAGAGGGAGTTGGG - Intronic
960229410 3:115207842-115207864 ACCTTAGTACAGATAGAGATGGG + Intergenic
962250055 3:133830562-133830584 ACATTTTTACAGGTGGAGATGGG - Intronic
962735740 3:138323636-138323658 AGATTTCTACAGTTGGTGATGGG + Intronic
964020187 3:152000705-152000727 TGTTTTATAAAGATGGGGATAGG + Intergenic
964020418 3:152003663-152003685 TGTTTTATAAAGATGGGGATAGG - Intergenic
964145261 3:153453188-153453210 ATTTGTGTCCAGATAGAGATAGG - Intergenic
964174854 3:153815499-153815521 TTTTATGTACAGATTGAGATAGG - Intergenic
965368796 3:167834641-167834663 ATTTGTGTACAGTTGGAAATAGG - Intergenic
965595825 3:170409980-170410002 ATATCTGTACAGTTGGAGATTGG - Intergenic
969884215 4:10200881-10200903 AGTGTTGTACAGCTGGTGGTTGG + Intergenic
970376838 4:15467346-15467368 AGTTTTGTGCAGGTAGAGGTAGG + Intergenic
971155705 4:24080188-24080210 AGATTTGGATACATGGAGATAGG - Intergenic
974506661 4:62782894-62782916 AGTTGTGAACAAATAGAGATAGG - Intergenic
974735886 4:65931539-65931561 TTTTTTGTAGAGATGGAGTTTGG + Intergenic
976084018 4:81388812-81388834 AGTATTCTAGAGATGGAGGTGGG + Intergenic
976097353 4:81523351-81523373 TTTTTTTAACAGATGGAGATAGG + Intronic
978304044 4:107302722-107302744 AATTTTGTAGAGATGGGGTTTGG - Intergenic
981467721 4:145093097-145093119 AGTATTCTACAGCTGGAGGTAGG + Intronic
981689439 4:147490731-147490753 AGTGTTGTCCATAGGGAGATGGG + Intronic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982425536 4:155254201-155254223 AGTTTTGTGCAAATGCAGTTGGG - Intergenic
982619112 4:157680607-157680629 AGATTTTGACAGATGGAAATTGG + Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983783090 4:171697620-171697642 AATATTGAACACATGGAGATAGG - Intergenic
984811754 4:183801605-183801627 GATCTTGTGCAGATGGAGATGGG + Intergenic
984850417 4:184147621-184147643 CGTTTTGTAGAGATGGGCATGGG - Intronic
987378636 5:17262301-17262323 AGCTTTCTACAGATGAGGATGGG - Intronic
989023468 5:37038349-37038371 AGTTTTATACTAATGGAAATTGG - Intronic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
990220339 5:53581473-53581495 GTTTATGTACAGCTGGAGATTGG - Intronic
991496971 5:67236475-67236497 AGTATTGTCAAGGTGGAGATGGG + Intergenic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
993799617 5:92316672-92316694 ATTTTTGTGCAAATGGAGAAAGG + Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994577613 5:101599520-101599542 AGTTTTGTACATTTTGAGAATGG - Intergenic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
995625678 5:114073925-114073947 AGTTTTGTACACAGTGACATAGG + Intergenic
996238325 5:121162470-121162492 AATTTTGTAAAGATGGAAATTGG + Intergenic
997017884 5:129958534-129958556 ACTTTTGTACAGAGCAAGATGGG + Intronic
997077171 5:130692874-130692896 CGTTTTGTGCACATGGAGATAGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
998212732 5:140212787-140212809 TTTTTTGTAGAGATGGAGTTTGG - Intronic
998257860 5:140602584-140602606 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1000748592 5:165066499-165066521 AGTTTTGAACAGGTTGAGTTTGG + Intergenic
1003410249 6:5855819-5855841 AGCTTTGTGCAGATGGACATGGG - Intergenic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1005252908 6:23967789-23967811 AGTTTTCTATAGTTGGTGATAGG + Intergenic
1006680003 6:35790102-35790124 ATTTTTGTAGAGATGGGGAGGGG + Intronic
1007602431 6:43090852-43090874 AGTTTTGTAAGGAAGGAGCTAGG + Intronic
1008081402 6:47198545-47198567 AGATTTGAACAAGTGGAGATTGG - Intergenic
1008855962 6:56087686-56087708 TGTTTTGTACAAATGCAGTTGGG - Intronic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009564188 6:65290215-65290237 AGTTTAGTAAAGATGGAGAAAGG + Intronic
1011334658 6:86246912-86246934 AGTTTTGCTCAGATGTAAATGGG + Intergenic
1012758787 6:103268450-103268472 AGTTTTCCCCAAATGGAGATAGG - Intergenic
1013398212 6:109765140-109765162 AGTTTGATACAGATGCAGTTAGG + Exonic
1015792989 6:136982541-136982563 TTTTTTGTAGAGATGGGGATGGG - Intergenic
1017576035 6:155805574-155805596 AGTTTTGTAGAGATAAATATAGG + Intergenic
1021568120 7:22034624-22034646 AGTATTGTGCTGATGGAAATAGG - Intergenic
1021711479 7:23420286-23420308 ATTTTTGTAGAGATGGGGTTTGG - Intronic
1022145994 7:27541031-27541053 TGTTTTGTACAAATGCAGTTGGG - Intronic
1022159258 7:27692436-27692458 TTTTTTGTAGAGATGGAGTTGGG - Intergenic
1022231011 7:28411623-28411645 AGTTTTGGATAGAGGGAGAGAGG + Intronic
1022245503 7:28555038-28555060 AGTTTTGTTCAGCTGGTGGTAGG + Intronic
1022702617 7:32775897-32775919 AGTTTTGTTATGATGAAGATTGG - Intergenic
1022906847 7:34866024-34866046 AGTTTTGTTATGATGAAGATTGG - Intronic
1024159164 7:46656756-46656778 AGTTTTCTGCAGATGACGATAGG + Intergenic
1026805833 7:73429305-73429327 ACCTTTGTAAAGAGGGAGATCGG + Intergenic
1027782793 7:82540746-82540768 ACTTATGTACAGATGTAGATAGG - Intergenic
1030246959 7:107393284-107393306 GGTTTTGTAAAGAGGGAGTTTGG - Intronic
1030246972 7:107393360-107393382 TGTTTTCTACAGATCGTGATGGG - Intronic
1031214308 7:118870701-118870723 AGTTTGGCTCAGATGAAGATTGG + Intergenic
1031849406 7:126845892-126845914 AGTGATGTAGAGAAGGAGATGGG + Intronic
1031888423 7:127265095-127265117 TGTTTTGGACAGAAGAAGATTGG - Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032099059 7:128957996-128958018 AGTTTTGGACAAAGGGAGGTCGG - Intronic
1033450164 7:141455241-141455263 AGTTGTGTACAGGTTGTGATAGG + Intronic
1033561072 7:142531459-142531481 AGTTTTGTTGAGATGGGGAAAGG + Intergenic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1034840390 7:154390367-154390389 AGTTTTGTTCTGAGTGAGATTGG + Intronic
1034893975 7:154863534-154863556 TATTTTGTAGAGATGGAGTTGGG + Intronic
1036672132 8:10797450-10797472 AGTTTTGAACACATGGTTATAGG + Intronic
1036808379 8:11850722-11850744 ATTTTTGTACTGATGGAAACTGG + Intronic
1037441914 8:18925207-18925229 TGTTTTGTAGAGATGGGGTTTGG - Intronic
1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG + Intergenic
1042145252 8:65721574-65721596 AGTGTTGTACAGATCTAGAATGG - Intronic
1042483154 8:69325487-69325509 AGTATTGTGCAGCTGGAGACCGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045801897 8:106111449-106111471 AGTTTTGCACTGCTGGATATTGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1047170051 8:122483965-122483987 AGTTTTGTTCAGCTGAAGTTGGG + Intergenic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1050173502 9:2846569-2846591 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1051999106 9:23254694-23254716 AGTTTTGTAAAGAATGAGCTGGG - Intergenic
1052529588 9:29664335-29664357 AGATTTGAACAGGTGGAGAAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054148858 9:61584710-61584732 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054184729 9:61942222-61942244 AGTTTTGCAAAGATGGAGCCTGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054468621 9:65515819-65515841 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054653778 9:67646275-67646297 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055788510 9:79896959-79896981 AGAATTGTCCACATGGAGATAGG - Intergenic
1058075778 9:100649279-100649301 ATTTTTGTACAAATGGAGAGGGG + Intergenic
1058263046 9:102860454-102860476 AATTTTCTCCAGGTGGAGATAGG + Intergenic
1059502823 9:114769934-114769956 ACTTTTGCACAAATGGAGAAGGG + Intergenic
1060239575 9:121891137-121891159 AGTTTAGAACAGCTAGAGATGGG - Intronic
1186162281 X:6790127-6790149 AGATATATACAGATGTAGATAGG + Intergenic
1187488658 X:19728831-19728853 AGTTATGTTCTGATGAAGATAGG + Intronic
1189114848 X:38331757-38331779 ATTTTTGTAGAGATGGGGTTTGG + Intronic
1189914404 X:45842675-45842697 AGTTTAGGACAGATGGAGTGTGG + Intergenic
1190393484 X:49955968-49955990 AGTTCTATACAGATTGGGATTGG - Intronic
1190852000 X:54253824-54253846 AATTTTGTACAGAGGTAAATTGG - Intronic
1194417788 X:93635213-93635235 TGTTTTCTAAAGATGGGGATGGG + Intergenic
1196351320 X:114733845-114733867 AGCTTGGTATAGATGAAGATTGG - Intronic
1199293338 X:146129914-146129936 ACTTTTGTACATATGGAACTTGG + Intergenic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic