ID: 1009408996

View in Genome Browser
Species Human (GRCh38)
Location 6:63343804-63343826
Sequence AACTGCTTTTAAAAGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009408996_1009409003 14 Left 1009408996 6:63343804-63343826 CCATGAGCCTTTTAAAAGCAGTT No data
Right 1009409003 6:63343841-63343863 GAAGGGAAATTCAGAGAGGTAGG No data
1009408996_1009409002 10 Left 1009408996 6:63343804-63343826 CCATGAGCCTTTTAAAAGCAGTT No data
Right 1009409002 6:63343837-63343859 GGCAGAAGGGAAATTCAGAGAGG No data
1009408996_1009409000 -4 Left 1009408996 6:63343804-63343826 CCATGAGCCTTTTAAAAGCAGTT No data
Right 1009409000 6:63343823-63343845 AGTTTTCTCTGGCTGGCAGAAGG No data
1009408996_1009409001 -3 Left 1009408996 6:63343804-63343826 CCATGAGCCTTTTAAAAGCAGTT No data
Right 1009409001 6:63343824-63343846 GTTTTCTCTGGCTGGCAGAAGGG No data
1009408996_1009409004 25 Left 1009408996 6:63343804-63343826 CCATGAGCCTTTTAAAAGCAGTT No data
Right 1009409004 6:63343852-63343874 CAGAGAGGTAGGAAGCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009408996 Original CRISPR AACTGCTTTTAAAAGGCTCA TGG (reversed) Intergenic
No off target data available for this crispr