ID: 1009413799

View in Genome Browser
Species Human (GRCh38)
Location 6:63394952-63394974
Sequence CAGTGCACACAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009413799_1009413807 27 Left 1009413799 6:63394952-63394974 CCTTCTTCCCTCTGTGTGCACTG No data
Right 1009413807 6:63395002-63395024 TTCAGTTCTCCATGCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009413799 Original CRISPR CAGTGCACACAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr