ID: 1009413807

View in Genome Browser
Species Human (GRCh38)
Location 6:63395002-63395024
Sequence TTCAGTTCTCCATGCACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009413803_1009413807 0 Left 1009413803 6:63394979-63395001 CCTGACAACTCCCTCTCCTTTCT No data
Right 1009413807 6:63395002-63395024 TTCAGTTCTCCATGCACTTGAGG No data
1009413799_1009413807 27 Left 1009413799 6:63394952-63394974 CCTTCTTCCCTCTGTGTGCACTG No data
Right 1009413807 6:63395002-63395024 TTCAGTTCTCCATGCACTTGAGG No data
1009413802_1009413807 19 Left 1009413802 6:63394960-63394982 CCTCTGTGTGCACTGCAGGCCTG No data
Right 1009413807 6:63395002-63395024 TTCAGTTCTCCATGCACTTGAGG No data
1009413801_1009413807 20 Left 1009413801 6:63394959-63394981 CCCTCTGTGTGCACTGCAGGCCT No data
Right 1009413807 6:63395002-63395024 TTCAGTTCTCCATGCACTTGAGG No data
1009413804_1009413807 -10 Left 1009413804 6:63394989-63395011 CCCTCTCCTTTCTTTCAGTTCTC No data
Right 1009413807 6:63395002-63395024 TTCAGTTCTCCATGCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009413807 Original CRISPR TTCAGTTCTCCATGCACTTG AGG Intergenic
No off target data available for this crispr