ID: 1009418911

View in Genome Browser
Species Human (GRCh38)
Location 6:63443561-63443583
Sequence CTCACTGCTGAGAGTCGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009418911_1009418918 18 Left 1009418911 6:63443561-63443583 CCAGACCGACTCTCAGCAGTGAG No data
Right 1009418918 6:63443602-63443624 TGCCTCCCAGCCTTGGAGCTTGG No data
1009418911_1009418916 11 Left 1009418911 6:63443561-63443583 CCAGACCGACTCTCAGCAGTGAG No data
Right 1009418916 6:63443595-63443617 CACCTGCTGCCTCCCAGCCTTGG No data
1009418911_1009418923 28 Left 1009418911 6:63443561-63443583 CCAGACCGACTCTCAGCAGTGAG No data
Right 1009418923 6:63443612-63443634 CCTTGGAGCTTGGATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009418911 Original CRISPR CTCACTGCTGAGAGTCGGTC TGG (reversed) Intergenic
No off target data available for this crispr