ID: 1009425281

View in Genome Browser
Species Human (GRCh38)
Location 6:63506962-63506984
Sequence AGGGAGTAGAAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009425278_1009425281 -5 Left 1009425278 6:63506944-63506966 CCCAGGGAAGCAGGAGTGAGGGA No data
Right 1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG No data
1009425275_1009425281 3 Left 1009425275 6:63506936-63506958 CCTGCAATCCCAGGGAAGCAGGA No data
Right 1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG No data
1009425279_1009425281 -6 Left 1009425279 6:63506945-63506967 CCAGGGAAGCAGGAGTGAGGGAG No data
Right 1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG No data
1009425273_1009425281 4 Left 1009425273 6:63506935-63506957 CCCTGCAATCCCAGGGAAGCAGG No data
Right 1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009425281 Original CRISPR AGGGAGTAGAAGAATGAGGA AGG Intergenic
No off target data available for this crispr