ID: 1009426252

View in Genome Browser
Species Human (GRCh38)
Location 6:63516849-63516871
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009426252_1009426256 3 Left 1009426252 6:63516849-63516871 CCTCTGTGGATGAGGTGACCTTG No data
Right 1009426256 6:63516875-63516897 TTGGAAGCTATATGTGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009426252 Original CRISPR CAAGGTCACCTCATCCACAG AGG (reversed) Intergenic
No off target data available for this crispr