ID: 1009437627

View in Genome Browser
Species Human (GRCh38)
Location 6:63636077-63636099
Sequence CGCTGCCGCCGCCGAAGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009437627_1009437636 28 Left 1009437627 6:63636077-63636099 CCTCCTCTTCGGCGGCGGCAGCG 0: 1
1: 0
2: 4
3: 22
4: 152
Right 1009437636 6:63636128-63636150 TAGCGCTCGTCTGGCGGAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 21
1009437627_1009437633 19 Left 1009437627 6:63636077-63636099 CCTCCTCTTCGGCGGCGGCAGCG 0: 1
1: 0
2: 4
3: 22
4: 152
Right 1009437633 6:63636119-63636141 TGCCAGTGGTAGCGCTCGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1009437627_1009437635 22 Left 1009437627 6:63636077-63636099 CCTCCTCTTCGGCGGCGGCAGCG 0: 1
1: 0
2: 4
3: 22
4: 152
Right 1009437635 6:63636122-63636144 CAGTGGTAGCGCTCGTCTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1009437627_1009437631 5 Left 1009437627 6:63636077-63636099 CCTCCTCTTCGGCGGCGGCAGCG 0: 1
1: 0
2: 4
3: 22
4: 152
Right 1009437631 6:63636105-63636127 CATCTTCCTCTTGCTGCCAGTGG 0: 1
1: 0
2: 1
3: 25
4: 278
1009437627_1009437637 29 Left 1009437627 6:63636077-63636099 CCTCCTCTTCGGCGGCGGCAGCG 0: 1
1: 0
2: 4
3: 22
4: 152
Right 1009437637 6:63636129-63636151 AGCGCTCGTCTGGCGGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009437627 Original CRISPR CGCTGCCGCCGCCGAAGAGG AGG (reversed) Exonic
900091919 1:924387-924409 TGCTGCCGCCGGCGGAGAGCGGG + Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901629009 1:10639208-10639230 CGCCGCCGCCGCCGCAGCTGGGG - Exonic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904940768 1:34164070-34164092 CGCTGCCGCTGCCGCAGCCGAGG + Intronic
906027223 1:42683230-42683252 CGCCGCCGCCGCCGCACACGTGG - Intronic
906639741 1:47434513-47434535 TGCTGCAGCCGCCAAAGAGCGGG - Intergenic
915018718 1:152760357-152760379 AGCTGCAGCCGCCGAGGAGGAGG - Exonic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1066464872 10:35642238-35642260 CGCTGCTCCCGCCGAGGAGGAGG - Exonic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1071784087 10:88880162-88880184 CGCCGCCGCCGCCACAGAGGAGG + Exonic
1071784091 10:88880165-88880187 CGCCGCCGCCACAGAGGAGGGGG + Exonic
1072102170 10:92239667-92239689 GGCTGCAACCGCCGAAGACGAGG + Exonic
1072679707 10:97498357-97498379 CGCTGCCGCGGCTGTGGAGGCGG - Exonic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072915525 10:99535457-99535479 CGCCGCCGCCGCCGCAGCAGCGG + Exonic
1072915527 10:99535460-99535482 CGCCGCCGCCGCAGCAGCGGCGG + Exonic
1073063519 10:100745667-100745689 CGCCGCCGCGGCCGAAGGGCCGG - Intronic
1075129495 10:119726069-119726091 CGCTGCCGCCGCCGCTGCCGGGG + Intergenic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1080351829 11:31393602-31393624 CGCTGCATCCTCTGAAGAGGAGG - Intronic
1087672752 11:101127549-101127571 CTCTGCCGCCGCCGCCGGGGCGG - Exonic
1090616769 11:128522270-128522292 GGCAGCCGCCGGCGGAGAGGAGG - Intronic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1096782016 12:53997060-53997082 TGCTGCCGCCTCCGCAGAGTGGG + Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1104810990 12:131620349-131620371 CTCTGCCGCCGCACAGGAGGGGG - Intergenic
1106269360 13:28138707-28138729 CGCCGCCGCCAGCGAGGAGGAGG - Exonic
1107540486 13:41384746-41384768 GGATGCCACCGCAGAAGAGGAGG - Intergenic
1110119770 13:71866572-71866594 CGCCGCCGCCGCCGAAGCGATGG + Exonic
1111951457 13:94712174-94712196 CGCTCCCGCCCCGGAGGAGGGGG + Exonic
1114557643 14:23571122-23571144 CGCTGCAGCCTCCGAGGAGTGGG + Exonic
1116657969 14:47674982-47675004 CGCCGCCGCCGCCGCAGCTGCGG - Intergenic
1118895376 14:69941319-69941341 CGCTGCCTCCTCCTGAGAGGTGG - Intronic
1119743210 14:77027297-77027319 CGCCGCCGCCGCCGCTGCGGTGG - Exonic
1120941698 14:89955914-89955936 CGCGGCGGCCGCCGAAGGGGCGG + Intronic
1122620966 14:103057479-103057501 CGCCGCCGCCGCCGCAGACTAGG + Intergenic
1122786146 14:104164135-104164157 CGCTGCAGCCGCCGCAGTGGGGG + Intronic
1125674249 15:41494062-41494084 CGCTGCGGCCGCCGCCGCGGGGG + Exonic
1127753436 15:62068009-62068031 CGCCGCCGCCGCCGTAGGTGTGG - Exonic
1128154839 15:65385718-65385740 CGCAGCCGGCTCCGAAGAGGAGG + Intronic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1136348990 16:29694998-29695020 TGCTGCCGCCGCTGCAGTGGAGG + Exonic
1136588488 16:31202727-31202749 CGCTGCAGCCGCCGACCAGGAGG + Exonic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1142227257 16:88883646-88883668 CGCAGCCACCGCAGAAGAGTCGG - Intronic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1144339730 17:14301589-14301611 CGCCCCCGCCGCCGGTGAGGAGG + Exonic
1144909911 17:18672510-18672532 CGCTGCCACCGCCGCAGCCGGGG - Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1146694525 17:34898430-34898452 CTCTACCGCTGCAGAAGAGGGGG + Intergenic
1147325434 17:39667561-39667583 CGGCGCCGCCCCCGAAGTGGCGG + Intergenic
1147971294 17:44220067-44220089 TGCTGCCGCCGCCGGGGAAGGGG + Intronic
1148084833 17:44987829-44987851 CGCCGCCGCCGCCGTAGATGGGG + Intergenic
1148826461 17:50397620-50397642 CGTCGCCGCCGCCGGAGGGGTGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1152677260 17:81648067-81648089 CGCAGCCACCGCCGGAGCGGCGG - Exonic
1152708890 17:81860402-81860424 CGCCGACGCCCCCGAGGAGGAGG - Exonic
1154001799 18:10487893-10487915 CTCTGCCCTCGGCGAAGAGGAGG - Exonic
1160138517 18:76296617-76296639 CACAGCCGCCGCCAGAGAGGGGG + Intergenic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161461903 19:4402721-4402743 CGCCTCCGCCGCCTGAGAGGAGG + Exonic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1165058785 19:33194928-33194950 GGATGCCGCGGCCGGAGAGGAGG - Intronic
1165850893 19:38849810-38849832 CACTGCCGCCGCCGTAGTAGCGG + Exonic
1166060219 19:40321272-40321294 CGACGCCACCGCCGACGAGGGGG + Exonic
1166543287 19:43619578-43619600 TGCAGCCGCCGCCGCAGAGCCGG - Exonic
1167237172 19:48322060-48322082 AGCAGCCGCCGCCGCGGAGGGGG - Intronic
1168458969 19:56538526-56538548 CGCAGCCGCCGCATAAGTGGTGG - Intergenic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
927887594 2:26728234-26728256 CGCTGCCGCCGTGGATGAGGCGG - Exonic
930717519 2:54606753-54606775 CGGTGCCGCCCTAGAAGAGGTGG - Intronic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
936446537 2:112600190-112600212 CTCTGCCGCCGACCAGGAGGTGG + Intergenic
942448371 2:176092970-176092992 CGCCGCCGCCACCGATGAGGAGG - Exonic
942565575 2:177263238-177263260 CTCTGCCCCTGCAGAAGAGGGGG + Intronic
945431725 2:209772234-209772256 CGCTGCCGCCGCCGCCGCTGAGG + Intronic
947936305 2:234007251-234007273 CCCTGCTGCGGCCGCAGAGGTGG + Intronic
948207742 2:236171577-236171599 CGCTGCCGCCGCCAGAGTCGAGG + Intergenic
948496919 2:238356594-238356616 CGCTGCCCCCTCCCAAGACGGGG - Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1170999442 20:21397467-21397489 AGCTGCCGCGGCCGAGGTGGCGG - Exonic
1173681554 20:44885791-44885813 CGCTGCCGCCGCCTGAGTAGTGG + Exonic
1175429062 20:58890008-58890030 CGCTCGCGCCGCGGAAGAGCGGG + Intronic
1176093420 20:63328939-63328961 CGCTGCTGCCTCAGAGGAGGAGG - Intronic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176680258 21:9815611-9815633 TCCTGCTGCCGCCGAAGCGGCGG + Intergenic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1180707372 22:17817918-17817940 CGCTGCAGCCACAGAAGAGGGGG - Exonic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1182243976 22:28940619-28940641 CGCTGCAGCCTCTGAAGGGGAGG - Intronic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
953099341 3:39809778-39809800 GGCTGCCGGCGGCGAAGAAGGGG - Exonic
953485080 3:43286931-43286953 CGCGGCCGCCGCCGCAGTGACGG - Intronic
953947734 3:47163886-47163908 CGCAGCCGCCTCCGAAGATGGGG - Exonic
956892299 3:73624702-73624724 CGCAGCCGGCGCAGAAGACGTGG + Exonic
962301893 3:134250658-134250680 CGCCGCCGCCGCCGCCGAAGAGG + Exonic
963240913 3:143001595-143001617 TGCTGCCGCCGCCGAAGGAGGGG + Exonic
963602580 3:147390954-147390976 CGCCGCCACCGCCGCCGAGGAGG + Exonic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
975986256 4:80203234-80203256 CGCGGCCGCCGCCGCAGCCGCGG - Exonic
977639865 4:99344993-99345015 TGCTGACGCCGACGAAGTGGTGG + Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
989229989 5:39074476-39074498 CGCCGTCGCCGCCGAGGGGGCGG - Intergenic
989229991 5:39074479-39074501 CGCCGCCGTCGCCGCCGAGGGGG - Intergenic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
995224708 5:109689791-109689813 CGCCGCCGCCGCCGACGCTGCGG - Exonic
996862814 5:128084232-128084254 CGCCGCCGCCGCCGCAGCAGCGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
1001476706 5:172055617-172055639 CGCTGCCCCCGCCGTTGATGTGG + Exonic
1003114301 6:3273175-3273197 CGCTGCTGCCGCACAAGAAGGGG - Exonic
1004208504 6:13614812-13614834 TGCTGCCACCGACGAAGACGCGG - Intronic
1005965599 6:30724340-30724362 GGATGCCACCGCAGAAGAGGAGG + Exonic
1007779812 6:44246387-44246409 CCCGGCCGCAGCCGGAGAGGCGG + Intronic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1013273403 6:108561603-108561625 CGCTGCCACCGCCGCAGCCGGGG + Exonic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1013793610 6:113860180-113860202 AGCTGCGGCCGCCGCCGAGGCGG + Exonic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1022106253 7:27199829-27199851 CGCGGCCGCCGCCGCAGCCGCGG + Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1029640255 7:101815897-101815919 CGCCGCCGCCACCGAGGACGCGG - Intronic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1034919733 7:155070340-155070362 AGCTGCAGCCTCCGAAGGGGTGG + Exonic
1035431710 7:158828449-158828471 CAGGGCCGCGGCCGAAGAGGGGG + Intronic
1038757297 8:30353285-30353307 GGATGCCACCGCAGAAGAGGAGG + Intergenic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1042040198 8:64581351-64581373 CGCTGGCGCCGCCGTGGAGGTGG - Exonic
1042859142 8:73295406-73295428 CGCTGCCGGCGCCGGTGATGAGG - Exonic
1046103905 8:109644691-109644713 CGCTGCCGCCGTCCAGGAGGAGG + Exonic
1047436665 8:124840497-124840519 TGCTGCTGTCGCCTAAGAGGTGG - Intergenic
1047454916 8:124999536-124999558 CGCTGTCGCCACCGAAACGGGGG + Exonic
1050472388 9:6007445-6007467 CGTTGCCACCGCGGAGGAGGAGG - Exonic
1057259553 9:93576333-93576355 CGCTCCCGCCGCCGGGAAGGCGG - Intergenic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1058948435 9:109880592-109880614 CGCTGGAACTGCCGAAGAGGAGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062381198 9:136287587-136287609 GGGTGCCGCAGCCGAGGAGGTGG - Intronic
1062537625 9:137027882-137027904 CGCTGCGGCCTCCGGGGAGGTGG - Exonic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1190008039 X:46758883-46758905 CTCCGCCGCCGCCCCAGAGGAGG + Exonic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1192657111 X:73003453-73003475 CGAAGCCGCCGCCGCAGCGGAGG + Intergenic
1192665009 X:73079548-73079570 CGAAGCCGCCGCCGCAGCGGAGG - Intergenic
1196684022 X:118495702-118495724 AGCTGCCGCCGCCGACGCCGTGG + Intergenic
1197198932 X:123732439-123732461 CGCGGCAGCGGGCGAAGAGGAGG + Intronic