ID: 1009437649

View in Genome Browser
Species Human (GRCh38)
Location 6:63636195-63636217
Sequence GTGTGGAAGGGGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2909
Summary {0: 1, 1: 0, 2: 21, 3: 273, 4: 2614}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009437649_1009437665 18 Left 1009437649 6:63636195-63636217 CCCTCCCCCATCCCCTTCCACAC 0: 1
1: 0
2: 21
3: 273
4: 2614
Right 1009437665 6:63636236-63636258 CCTCTCCGCCCCTCCCGCGGCGG 0: 1
1: 0
2: 2
3: 31
4: 228
1009437649_1009437660 -5 Left 1009437649 6:63636195-63636217 CCCTCCCCCATCCCCTTCCACAC 0: 1
1: 0
2: 21
3: 273
4: 2614
Right 1009437660 6:63636213-63636235 CACACGCACAGCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 134
1009437649_1009437663 15 Left 1009437649 6:63636195-63636217 CCCTCCCCCATCCCCTTCCACAC 0: 1
1: 0
2: 21
3: 273
4: 2614
Right 1009437663 6:63636233-63636255 GGGCCTCTCCGCCCCTCCCGCGG 0: 1
1: 0
2: 3
3: 22
4: 263
1009437649_1009437659 -6 Left 1009437649 6:63636195-63636217 CCCTCCCCCATCCCCTTCCACAC 0: 1
1: 0
2: 21
3: 273
4: 2614
Right 1009437659 6:63636212-63636234 CCACACGCACAGCGCCTCCGCGG 0: 1
1: 1
2: 1
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009437649 Original CRISPR GTGTGGAAGGGGATGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr