ID: 1009438061

View in Genome Browser
Species Human (GRCh38)
Location 6:63640932-63640954
Sequence GCCAAAAATGTCTCTAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 5, 2: 35, 3: 83, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009438058_1009438061 -5 Left 1009438058 6:63640914-63640936 CCCTTTCCAGTTGTGATGGCCAA 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG 0: 1
1: 5
2: 35
3: 83
4: 216
1009438059_1009438061 -6 Left 1009438059 6:63640915-63640937 CCTTTCCAGTTGTGATGGCCAAA 0: 1
1: 0
2: 2
3: 33
4: 267
Right 1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG 0: 1
1: 5
2: 35
3: 83
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009438061 Original CRISPR GCCAAAAATGTCTCTAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904486553 1:30828546-30828568 GCCAAAGAACTCTCTATACATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916865001 1:168847014-168847036 GCAAAAAATGTCTCAAGTAATGG + Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921494357 1:215820231-215820253 GAAAAAAATGTGTGTAGACATGG - Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1063992305 10:11579316-11579338 GCCATTAATGTTTTTAGACAGGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1071038478 10:81277325-81277347 GCTTAAAATATCTCTAAACATGG + Intergenic
1071403022 10:85296862-85296884 GCCAACAATTTTTCTAGAAATGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075071221 10:119321073-119321095 GCCAAACATTTGTCTAGACGTGG + Intronic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079693507 11:23450051-23450073 GCCAAACATGGCACAAGACAAGG + Intergenic
1080050900 11:27857945-27857967 GCCATAAATATCTCGAGTCAGGG + Intergenic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086273661 11:85097799-85097821 GCCAAGAAAGTCCCTAGACCTGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087890274 11:103530353-103530375 GCCAAAGATGGCTTTATACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092026853 12:5247870-5247892 GCCATAAAAGGCGCTAGACAGGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095044120 12:37480777-37480799 GCCAAAATTGTCTCTTATCAGGG - Intergenic
1095119486 12:38399707-38399729 GCAATAATTGTCTCTAGATAAGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1096564607 12:52468182-52468204 GCCAAAAATGTTTCTCCACTGGG + Intergenic
1097016298 12:55989724-55989746 GCCAGAAATGTCACTAGCTAAGG - Intronic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1100634707 12:96424685-96424707 GACAAAAATGTCTGTGTACAAGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102444137 12:112988554-112988576 GCCTAAAATTTCTCTGTACATGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108004330 13:45932064-45932086 GCCAAAGATGGCTGTAAACAGGG - Intergenic
1108139384 13:47402865-47402887 GAGAAAAATGTATCTAGATAGGG - Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109329548 13:60911199-60911221 GGCAAACATGTCTCTGAACAAGG + Intergenic
1110174911 13:72544591-72544613 GCCAAAGAAGTTTCTAGTCAAGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1113195983 13:107806577-107806599 GCAAAAAATGTCTATACATAAGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115785354 14:36819582-36819604 GCCTTAAAAGTCTCAAGACAAGG + Intronic
1115857331 14:37644644-37644666 GCCATAAGAGTCTCTACACAAGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117155047 14:52930789-52930811 GCCAATAATGTGTAAAGACAGGG + Intronic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1118974191 14:70663364-70663386 CCAAAAAATGTCTCTGGAAATGG - Intronic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1123121760 14:105919979-105920001 GCAAAAAATGTCCATAGACAGGG - Intronic
1202942665 14_KI270725v1_random:168440-168462 GCCAAAATTGTCTCTTATCAGGG - Intergenic
1123404463 15:20011630-20011652 GCAAAAAATGTCCATAGACAGGG - Intergenic
1123513796 15:21018277-21018299 GCAAAAAATGTCCATAGACAGGG - Intergenic
1124391801 15:29265706-29265728 GCCATAAATTTATCTATACATGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130904259 15:88228754-88228776 GCCAACAAGCTCTCTAGATATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131143551 15:89997681-89997703 CCGAAATATGTCTCTAGATAGGG + Intergenic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136084827 16:27877407-27877429 TACAAAAATGAATCTAGACAGGG - Intronic
1136292419 16:29283675-29283697 GCAAACAATGAATCTAGACATGG - Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1138828909 16:60355181-60355203 GCCTAAAATGACTGTAGCCAAGG + Intergenic
1138855107 16:60681350-60681372 GCCAAAAATGTCAGAAAACATGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140755965 16:78066880-78066902 GTTAAAAATGTTTCTAGGCACGG + Intergenic
1141181902 16:81759320-81759342 GCCAAAAATGTATAAAGAGATGG + Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142098313 16:88257694-88257716 GCAAACAATGAATCTAGACATGG - Intergenic
1144108011 17:12003625-12003647 CCGTAAAATGTCTTTAGACAAGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145575859 17:25063412-25063434 GCCAAAGATGTCTTTGGAAACGG + Intergenic
1145589914 17:25267184-25267206 GCCAAAGATGTCTTTGGAAACGG + Intergenic
1145595029 17:25341997-25342019 GCCAAAGATGTCTTTGGAAACGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148094784 17:45044772-45044794 CCCTAAACTGTCTCAAGACAAGG + Intronic
1150270448 17:63861003-63861025 GCCAAGAAGCTCTCTAGAAATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1151783459 17:76263048-76263070 GCCAGAAATGTCTCTCCCCAGGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1156535367 18:37859037-37859059 GACAAAAATGTCACTATATAAGG - Intergenic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1161079069 19:2301420-2301442 GGCACAAATGTCCCTGGACACGG + Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163240353 19:16059018-16059040 GTCAAAACTGTTTCTGGACACGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168371973 19:55843301-55843323 CCCTATAATGTGTCTAGACATGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925701519 2:6643649-6643671 GCCAAAACTGAATCTAGACACGG + Intergenic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
927072983 2:19549037-19549059 GCCAGAAATCTCTGTAGCCACGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930632758 2:53771711-53771733 GCCAACACAGTCTCTAGATAAGG + Intronic
931251527 2:60535426-60535448 GCCAAACCTATCTCTAAACATGG + Intronic
932523779 2:72442331-72442353 GCAAAAAATGGCACAAGACAAGG + Intronic
934147013 2:89104856-89104878 GCCAAAATATTCTCTACACATGG - Intergenic
935891397 2:107682693-107682715 CACAATAATGTATCTAGACATGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
939786218 2:146516563-146516585 GCTAACCATGTTTCTAGACATGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941922635 2:170867047-170867069 GCAAAAACTGACTCAAGACATGG - Intergenic
942565731 2:177264070-177264092 GGCAAAAATGTGCCTAGTCACGG - Intronic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947684789 2:232073400-232073422 GCGGAAAATGTCTGTGGACATGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947917841 2:233846038-233846060 GTCATAAACTTCTCTAGACATGG - Intronic
1169716225 20:8621622-8621644 GCCTAAAATATCGCTAAACAAGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175422507 20:58843416-58843438 GCTAAAAATGGCTCTGGAAAAGG - Intronic
1175917555 20:62433739-62433761 GCCACAACTGTTTCTAGCCAGGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181890317 22:26057023-26057045 GCCAGAAATGTGTCTCTACAGGG - Intergenic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182364802 22:29771354-29771376 GCCAAAAATTTTTAGAGACAGGG - Intergenic
1182985301 22:34710631-34710653 GCCAAAATTAACACTAGACATGG + Intergenic
1183156402 22:36078893-36078915 TCAAAAAAAGTTTCTAGACAAGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183811806 22:40263963-40263985 GAGCAAAATGGCTCTAGACAGGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
949969274 3:9389495-9389517 GCCAAAAATTTTTTTAGAGATGG - Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
959930954 3:111981389-111981411 GCCAAAAATCTCACAAGAGAGGG + Intronic
960591097 3:119366676-119366698 GCCAAAGATTTCTCTTGTCAAGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962698175 3:137971317-137971339 GCCTAAAGTCTCACTAGACAGGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
965455091 3:168889646-168889668 GCTAAATTTGTCACTAGACAGGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
973036018 4:45407519-45407541 GCCAAACATTTGTCTAGACTGGG + Intergenic
976047022 4:80962363-80962385 GCAAAATAGGTCTCTATACAGGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977451075 4:97198765-97198787 GAGTAATATGTCTCTAGACACGG + Intronic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
980457412 4:133063371-133063393 GACAAAATTGTCTCTTTACAAGG + Intergenic
981027063 4:140087334-140087356 GACAAAAATGTCTTTAGAATGGG - Intronic
981596024 4:146423514-146423536 GCAAAGACTGTCTCTAGGCAAGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983653922 4:170061376-170061398 GCCAAAAATGTCCCTTTCCAAGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985063104 4:186097418-186097440 GCTAAGCATGTCTCTAGACTGGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990364310 5:55054254-55054276 GACAGAAATGTTTCTAGCCAGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993056570 5:82988287-82988309 TCCCCAAATGTCTATAGACAAGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
997277127 5:132603790-132603812 GCTAAAATTGTATCTAGAAATGG + Intronic
997771855 5:136562488-136562510 GCCACAAATGTGCCTAGAAAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
1000846157 5:166282851-166282873 TGGAGAAATGTCTCTAGACATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003937756 6:10993591-10993613 GGAATTAATGTCTCTAGACATGG + Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007118054 6:39357809-39357831 GCCAAAAACAAATCTAGACATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014691874 6:124572040-124572062 TCCGAAAATGTCTCTGGACTTGG - Intronic
1017005028 6:150023481-150023503 GCCATAAATATCTCTGGAGAAGG - Intronic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1020728583 7:11849432-11849454 CTCTAAAATGTCTCTGGACACGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023561947 7:41484292-41484314 GGAAAAAAAGACTCTAGACAAGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029380038 7:100207755-100207777 GCCAACAATTTCTCAAGATATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030296460 7:107933679-107933701 GACAAAACTCTCTCTACACAAGG + Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1035415076 7:158676601-158676623 CCCAAATATGTTTCAAGACAGGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037263649 8:17035884-17035906 GGGAAGAATGTCTCTAGGCAAGG + Intronic
1039068361 8:33628803-33628825 GCCAGAAATGAGGCTAGACAGGG - Intergenic
1039121665 8:34154805-34154827 GACAAAAATGGTTTTAGACAGGG + Intergenic
1040007364 8:42631625-42631647 GCCAAAAGTGTCTGTGGCCAGGG + Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1045219241 8:100181168-100181190 GCAATAAAAGTCTCAAGACATGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047566135 8:126046501-126046523 CCCAGAAGTGTCTCTAGGCATGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050826474 9:9952371-9952393 GCCAAAAATGCCTGTGGTCAAGG - Intronic
1051705745 9:19878053-19878075 GCCCAAAATGCCTCTGCACAGGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188763161 X:34057186-34057208 GACAAAAATGTGTCTTGGCAGGG - Intergenic
1188993548 X:36853755-36853777 GAAAAAAATGACTCTAGACATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1194498486 X:94649685-94649707 GATAAAAATGTGGCTAGACATGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197171041 X:123434681-123434703 GCCAAAAAGGCCTCTGGAAAAGG + Intronic
1197729823 X:129800048-129800070 GCCAGAAAGCTCTCTAGACTGGG + Intergenic
1198204419 X:134452521-134452543 GGCAAAAATGTTTTGAGACAGGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201356204 Y:13099285-13099307 GGCTAACATGTCTCTGGACAAGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic